From Oligonucleotide Design to Analytical Characterization
eBook
Published: August 27, 2026
Brought to you by
Shimadzu Corporation
Shimadzu is a world-leading manufacturer of analytical instrumentation. In every corner of the world, their products and services are being used by customers to develop a variety of new products to protect and restore the environment and deliver better health and lifestyles to people. With pride in these achievements firmly in mind, they strive to improve their technologies further and enhance their knowledge so that they can offer even greater technologies, products and services.
Credit: Shimadzu.
Oligonucleotide therapeutics span a range of modalities, including antisense oligonucleotides, siRNA, aptamers, and miRNA, each with its own route to influencing biological targets.
As candidates move through synthesis, purification, characterization, and scale-up, researchers need analytical approaches that can examine target products, related impurities, and molecular characteristics at different stages of development.
This eBook guides readers through the analytical workflow for oligonucleotide therapeutics, from method development and purification to molecular characterization, quality control, and pharmacokinetic analysis.
Download this eBook to explore:
- The different types of oligonucleotide therapeutics and the biological mechanisms behind their activity
- How chromatography and mass spectrometry can support purification, molecular weight confirmation, and impurity analysis
- Analytical approaches used to support oligonucleotide projects from early development through scale-up and quality control
Oligonucleotide Therapeutics
Solution
C10G-E097B
Inhibition of DNA transcription
and gene expression
Inhibition of signal
transduction
Inhibit functionality by binding to a target protein
Show efficacy by activating
innate immunity
TLR9
Endosome
Decoy
Types and Characteristics of Oligonucleotide DNA
Cell
Nucleus
Oligonucleotide therapeutics are comprised of a few to several dozen nucleic acids (including modified ones) and
chemically synthesized. Oligonucleotide therapeutics can effectively act on specific diseases and are easy to design
and synthesize. These characteristics can faster to find new therapeutic candidates.
CpG oligo
Aptamer
Target Protein
Transcription
factors
This is a single strand of DNA or RNA
that forms a thermodynamically stable
conformation through complementary
sequences within the molecule.
It binds directly to and acts on
target proteins.
This binds to proteins called
transcription factors that regulate
gene expression, preventing
them from binding to the genome
and signaling an immune
response.
This is single-stranded DNA with a sequence
of cytosine and guanine linked by
phosphodiester bonds (CpG motif). It is taken
up by endocytosis and activates innate
immunity by acting on Toll-like receptors
9 (TLR9) expressed on
endosomal membranes.
Silence target gene expression by
supplying miRNA
Inhibit gene expression by binding to target RNA
RISC
Complex
Oligonucleotide Therapeutics
mRNA
miRNA
miRNA
However, oligonucleotide therapeutics are degraded and excreted rapidly after administration by exonucleases
and endonucleases that are abundant in blood and cells. This problem is being addressed by the introduction of
modified oligonucleotides to improve chemical stability in vivo and by the development of lesion-targeted DDS
(drug delivery systems) technologies.
miRNA
Antisense Ribozyme
siRNA
Protein
Note: Not all oligonucleotides therapeutics are applicable.
This inhibits gene expression by
binding to the sense chain mRNA
encoding the target protein.
This is an RNA with enzymatic
activity that is coordinated by
metal ions. It inhibits protein
expression by binding to and
cleaving target mRNA.
This is a double-stranded RNA of
about 21 ~ 23 bases. It inhibits
protein expression by degrading
mRNA of target genes.
miRNAs are regulatory RNAs that
regulate gene expression.
Silence target gene expression
by supplying miRNA.
4
Synthesis
Crude purification
Purification Molecular weight
confirmation of
products after
crude purification
Optimization of
parameters for separating
target products
and impurities
Molecular weight
confirmation and
sequencing of target
products and impurities
Molecular weight
confirmation of target
products and impurities
in the collected sample
Analytical Instruments Utilizing Synthesis and Purification Processes Optimization MALDI-MS
LC-MS (SQ)
Nexera Prep
LCMS-2050
MALDImini-1 LCMS-9050
MALDI-8030 LabSolutions LCMS-2050
Insight Biologics
LabSolutions MD
HPLCLabSolutions MD
LC-MS (SQ)
LC-MS (Q-TOFSQ)
MALDI-MS
Oligonucleotide Synthesis
Oligonucleotide Purification Characterization and Analysis Laboratory Scale Optimization of
synthesis parameters Feedback
Optimization of
purification parameters Feedback
MALDI-MS
LC-MS (SQ)
5
Nucleic acid synthesis and purification
Before scaling up After scaling up
Melting point
measurement of
target products
Residual solvent
analysis
Elemental impurity
analysis
Quantitative analysis
and spectrum
confirmation
Quantitative analysis
and molecular weight
Molecular weight
confirmation of
partially purified
products
Molecular weight confirmation
and sequencing of target
products and impurities
in the collected matter
Approaches for difficult
samples to separate
and analyze using
conventional methods
of oligonucleotide Therapeutics
Supercritical Fluid
Chromatography (SFC)
LC-MS (TQ)
MALDI-MS
LC-MS (SQ)
LC-MS (Q-TOFSQ)
MALDI-MS
Tm Analysis System
UV-1900i Plus
Brevis GC-2050
ICPMS-2050
LCMS-8060RX
Nexera UC
Tm analysis GC
UV ICP-MS
Development of
New Analysis Methods
Evaluation of
correlation between before
and after scaling up
Pharmacokinetics
Method Development
Scaling Up
Synthesis, Crude Purification,
and Purification Quality Control
Manufacturing
process Analysis test
MALDImini-1 LCMS-9050
MALDI-8030 LabSolutions LCMS-2050
Insight Biologics
6
Oligonucleotide Synthesis
Characterization and Quality Control
Column and Mobile Phase Screening
Separation column
Aqueous mobile phases
Organic solvents
Step1
Step2 Optimization of LC Parameters
Automatic generation of analysis schedule
Continuous analysis under multiple conditions
Continuous analysis under multiple conditions
Automatic peak tracking
Automatic search for optimal conditions from acquired data
(ranking of chromatograms based on Evaluation Values)
Mobile phase blending function
Column switching function
Parameters for Optimization (Examples)
Column oven
temperature
Organic solvent
composition Gradient conditions
Automatic generation of analysis schedule
Optimization of gradient conditions (AI search)
Search for optimal conditions using design space
Analysis under the optimized conditions
Alkylamine
(type and concentration)
HFIP concentration
Methanol/acetonitrile
mixture ratio
Screening Parameters (Examples)
Efficient Method Development of Oligonucleotides
Using LabSolutions MD
7
Features
Improving Efficiency of the Entire Method Development Workflow
LabSolutions™ MD improves method development efficiency by taking an Analytical Quality by Design (AQbD) approach.
This software efficiently develops highly reliable analysis methods by configuring mobile phases, columns, and other parameters using an analysis
function that automatically generates analysis schedules with the experimental design method and a data analysis function that plots a design
space and predicted chromatogram.
Initial screening is based on parameters that have a major effect on peak retention time and separation, such as the pH of aqueous mobile phases,
the mixture ratio of organic mobile phases, and the type of column. LabSolutions MD quickly searches vast amounts of data to determine the optimal
analysis conditions.
Validation verifies that small variations in the optimized analytical condition settings affect measurement values only within an allowable range.
With the analytical conditions determined by initial screening results as
a starting point, optimal setting levels are verified for other parameters,
such as pump gradient and column oven temperature conditions.
Experimental design can be used to reduce the number of experiment
data points.
The relationship between factors and responses can be visually represented as a design space.
Solution for Method Development and Analytical Quality by Design
LabSolutions MD
Ranking Based on Each Condition
and Evaluation Value
Comparison of Chromatograms with High
and Low Evaluation Value
2.0
1.5
1.0
0.5
0.0
0.0 2.5 5.0 7.5 10.0 min
Chromatogram with high score
Chromatogram with low score
Resolution of n- < 0.7
resolution of n- -
Design Space for Resolution of FLP and
Related Impurities
Overlay of Design Spaces of Resolution and
Retention Time of Last Eluting Peak
Full Factorial Design
Data point
Reduce data points
Box-Behnken Design Central Composite Design
Step 1: Initial Screening
Step 2: Optimization
Step 3: Robustness Evaluation
8
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
This data analysis software can be used for every process, from development to quality
control, and with a wide variety of mass spectrometers.
Entering Sequence Information for Oligonucleic Acids in Target Products
・If sequence information is entered, structural formulas are shown visually for easier checking.
・ Sequence information for created target products can be saved within data analysis methods. User-specified parameters can be referenced even if
using a variety of mass spectrometers (SQ, Q-TOF, or MALDI).
Applicable Models
MALDI-MS
MALDI-8030
MALDI-8020
MALDImini-1
LCMS-QTOF
LCMS-9050
LCMS-9030
LCMS-SQ
LCMS-2050
LCMS-2020
Input oligonucleotide sequences Base modifications can be added and edited
The structural formula of sequences is shown in real time
In the window for setting the oligonucleotide sequences, the structural
formula of the sequence that was entered is displayed in real time,
enabling quick and easy verification of the information. Also, the
nucleobases used in the sequence, as well as the backbone linker, ribose,
and base modifications, can be added and edited.
Software for Oligonucleotide Characterization
LabSolutions Insight Biologics
Confirmation after Crude Purification ✓ ✓ ✓
Confirmation after Purification ✓ ✓ ✓
Quality Control ✓ ✓
9
Switchable coverage display
Checking ion intensity
and coverage
Checking the fragment
sequence
Modification positions are also clearly identified
Data Analysis of MS Spectra
(Simple Molecular Weight Confirmation of Target Products and Impurities)
Mass information for specified target products and impurities is automatically identified based on results from analyzing their molecular weight information. Identifying
only the principal components requires less than one second.
Only the two LCMS parameter settings specifically required for multi-charged ion analysis of nucleic acids are specified (charge state range and instrument mass accuracy
level).
Component Chromatogram Display Note: It cannot be used for data acquired with MALDI.
・Existing impurity peaks are easily identifiable in chromatograms.
Based on measured mass spectra, chromatograms are displayed based on a combination of all charge state differences and isotope spectra. This
enables a comprehensive display.
・ Both UV and MS chromatograms can be checked at the same time. Component ratios can be calculated based on a combination of UV and MS
peak area values.
MS/MS Sequence Analysis (Detailed Sequencing of Target Products and Impurities)
The software includes a coverage display which indicates fragment spectral
assignments. The coverage display switches to match the items to be checked.
Reports can also be output.
The MS/MS DDA mode for automatic fragment acquisition and analysis is used for
sequencing.
For data analysis, the software automatically searches all data for precursor ions of
components identified by sequencing, which can be expected to increase speed and
improve coverage. This means precursor information for each component does not
need to be entered manually to configure analysis settings.
10
Oligonucleotide Analysis by Ion Exchange
Chromatography (IEX)
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
Conclusions
By using Nexera XS inert and Shim-pack Bio IEX, it is possible to reproducibly separate the desired oligonucleotide from impurities such as protecting
groups generated during chemical synthesis or oligonucleotides with different chain lengths generated by incomplete synthesis.
• Short chain oligonucleotides can be separated based on the base unit.
• Oligonucleotides can be separated from impurities, such as protecting
groups used in the chemical synthesis process.
• Analysis can be performed using mobile phases with high salt
concentrations and a wide pH range.
benefits
Methods and Results
Sample 5‘-TCTTGGTTACATGAAA-3‘ (16 mer)
5‘-TCTTGGTTACATGAAAT-3‘ (17 mer)
5‘-TCTTGGTTACATGAAATC-3‘ (18 mer)
5‘-TCTTGGTTACATGAAATCC-3‘ (19 mer)
5‘-TCTTGGTTACATGAAATCCC-3‘ (20 mer)
Conc., Volume 5 μmol/L, 4 μL
Preparation Dilution in ultrapure water to the concentrations above.
Analytical
Conditions
As shown in Table 1
Results Target oligonucleotides in 20 mer and 4 sequences that were
deleted from n-1 to n-4 on the 3’ terminus of target were
prepared as impurities derived from the synthesis. All of them were
unmodified single-stranded DNA and synthesized by a solid phase
synthesis (HPLC-purified). Figure 1 shows a chromatogram of a
mixture of five-sequence oligonucleotide. Each oligonucleotide
was separated by their length. Table 2 shows the relative standard
deviations (% RSD, n = 6) of the retention time and area of the 16 -
20 mer oligonucleotide mixture, with RSD% less than 1% for both
parameters.
Then, a mixture of five oligonucleotides was prepared (four of them
were HPLC-purified while 1 was only desalted) and compared with
the mixture of all HPLC-purified nucleotides (Figure 2). The target
oligonucleotides were completely separated from impurities, such
as free protecting groups and shorter length oligonucleotides.
Table 1 Analysis Conditions
System : Nexera XS inert
Column : Shim-pack Bio IEX Q-NP
(100 mm × 4.6 mm I.D., 5 μm)
Mobile phase A : 10 mmol/L NaOH
Mobile phase B : 10 mmol/L NaOH containing 1 mol/L NaClO4
Flow rate : 0.8 mL/min
Time program :
(B Conc. )
25-32.5% (0-15 min) → 100% (15-20 min) →
25% (20-25 min)
Column temp. : 30 °C
Injection volume : 4 μL
Detection : UV 260 nm (SPD-M40), UHPLC standard cell
Vial : Shimadzu 1.1 mL sample vial
Figure 1 Chromatogram of oligonucleotides mixture
Figure 2 Chromatograms of the oligonucleotide mixture containing impurities
Table 2 Relative standard deviation (% RSD) of each component (n = 6)
Length(mer) Retention time Area
16 0.138 0.224
17 0.105 0.335
18 0.098 0.494
19 0.085 0.161
20 0.075 0.307
1 : 5’- TCTTGGTTACATGAAA -3’
2 : 5’- TCTTGGTTACATGAAAT -3’
3 : 5’- TCTTGGTTACATGAAATC- 3’
4 : 5’- TCTTGGTTACATGAAATCC -3’
5 : 5’- TCTTGGTTACATGAAATCCC -3’
0.0 5.0 10.0 min
1
3
2
4
5
Protecting groups
Shorter length of
oligonucleotides
5 mixed oligonucleotides
(including desalted oligonucleotides)
5 mixed oligonucleotides
(HPLC-puri ed)
11
Nexera XS inert
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 min
0
10
20
30
mAU
ADP AMP
ATP
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 min
0
10
20
30
mAU
ADP
AMP
Nexera XS inert
Sharp peaks
Excellent separation
Material that inhibits
adsorption
Stainless steel tubing
Metal-sensitive
compounds
Adsorption to internal surface
Poor peak shape
Peak tailing
Standard UHPLC (stainless steel-based)
Features
The potential adsorption of an analyte onto wetted surfaces of UHPLC
instruments poses some critical challenges when analyzing biomolecules.
While elevated pressure tolerance is required to achieve optimal
chromatographic separation when using small particle size columns, the
inertness of the wetted surfaces is also of the utmost importance, as is
resistance to corrosion due to the use of mobile phases with high salt
concentrations and extreme pH values.
The Nexera XS inert system offers the ideal solution for the separation of
biomolecules by combining the elevated pressure tolerance of a UHPLC
system with complete inertness of the sample flow path, ensured by the
absence of wetted metal surfaces and ultra-high resistance to corrosion.
Finger Tight Fittings for Simple and Secure Connections
Nexera XS inert systems feature tubing connections with unique finger-tight fittings.
They can achieve connections with up to 105 MPa of pressure capacity without creating
any dead volume.
Resolution without Restrictions
The Nexera XS inert system is equipped with unique technology that ensures the complete inertness of the sample flow path. The system provides
excellent peak shape and unsurpassed chromatographic separation by effectively inhibiting the adsorption of target compounds to internal surfaces.
Unconstrained Recovery and Sensitivity
Reduces sample loss due to adsorption to metal surfaces and achieves excellent sensitivity.
Assured Reliability and Reproducibility
Reliable data for metal-adsorbing compounds with high reproducibility.
Clear Resolution without Restrictions
Improves peak shape and achieves excellent chromatographic separation.
System Controller
SCL-40, CBM-40/40lite
Used to coordinate actions of the overall
system, this controller offers intuitive operation
that minimizes the stress involved in operating
the system, from startup to shutdown.
12
Improvement of Oligonucleotide Peak Shape Using
Automatic Pretreatment Function (Co-injection)
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
• Sample dilution can be automated using the automatic pretreatment function
“co-injection” for purified fractions of oligonucleotides containing high
concentrations of salts.
• The automatic pretreatment function “co-injection” enables the simultaneous
injection of a sample and a selected co-injection solvent. The co-injection solvent
and its injection volume can be easily set via LabSolutions MD interface.
benefits
Introduction
In HPLC analysis, the composition of the sample solvent is critical for
achieving proper peak shape. If the sample solvent is a stronger eluting
solvent than the mobile phase, sample band condensation at the column
inlet may be insufficient, leading to sample band broadening. For
instance, increasing the organic solvent ratio in the sample solvent to
dissolve low-polar compounds may deteriorate the peak shapes of earlyeluting
compounds in reversed-phase chromatography. Oligonucleotides
are synthesized using the phosphoramidite method and subsequently
purified by anion exchange chromatography or reversed-phase ionpair
chromatography (RPIP). Purified fractions from anion exchange
chromatography often contain high concentrations of salts, such as
sodium chloride (NaCl) and sodium bromide (NaBr). When these purified
fractions are analyzed using RP-IP, the high salt concentration in the
sample solvent may interfere with the ion-pair formation capacity of the
oligonucleotides. This interference can result in improper peak retention
and adversely affect the chromatogram.
Analytical Conditions
The analytical conditions are shown in Table 1. Two types of salts, 3 mol/
L NaCl and 3 mol/L NaBr, were added to the sample solvent to simulate
purified fractions containing high concentrations of salts. To assess the
effects of co-solvents and co-injection volumes on peak shape, four
different co-solvents were used : water and three solutions containing
HA (hexylamine) at concentrations of 10, 30, and 50 mmol/L, each
prepared in 100 mmol/L HFIP (1,1,1,3,3,3-hexafluoro-2-propanol).
Additionally, three injection volumes (1, 3, and 5 μL) were evaluated. By
simply entering the vial numbers and injection volumes of the co-injection
solvents via the LabSolutions MD (red frame in Figure 2), the autosampler
automatically adjusts the co-injection solvent types and volumes during
analysis. This enables automated comprehensive evaluation of conditions,
greatly reducing manual labor.
“Co-injection” Function
The co-injection function, equipped in autosamplers, provides automatic
pretreatment. A specified amount of reagent or solvent from any vial can
be mixed with the sample solution in the needle and injected (Figure 1).
Figure 2 Setting Screen of co-injection (LabSolutions MD)
Vial 2 : Co-solvent 1, Vial 3 : Co-solvent 2, Vial 4 : Co-solvent 3,
Vial 5 : Co-solvent 4
Figure 1 Flow Diagram of Co-injection Sequence
Sample vial Co-solvent vial Injection port
Sample
aspiration
Co-solvent
aspiration
Simultaneous injection
of sample and co-solvent
13
Conclusion
When purified fractions of oligonucleotides containing high concentrations of salt are analyzed by RP-IP, the ion-pair formation capacity is suppressed,
and peaks may not be properly retained, resulting in partial early elution as a split peak. Pretreatment, such as desalination or dilution of samples, is
usually required before analysis, but it is time-consuming. The co injection function, equipped in Nexera series autosamplers, allows for the simultaneous
injection of a desired solvent with purified fractions, providing automatic pretreatment that enables the direct analysis of oligonucleotides in purified
fractions with high salt concentrations. In particular, when many purified fractions need to be analyzed, significant labor savings can be achieved
because the necessary pretreatment procedures are automated for all fractions. The optimal co-injection solvent and volume depend on the analytical
conditions, such as oligonucleotide sequence and mobile phase composition. Therefore, although optimization of conditions is required each time, the
use of LabSolutions MD enables efficient comprehensive evaluation of conditions.
<Acknowledgments>
A part of this work was supported by AMED under Grant Number JP21ae0121022, JP21ae0121023, JP21ae0121024 (Project leader: Satoshi Obika).
Chromatograms obtained without the co-injection function are shown
in Figure 3 (sample solvent : NaCl). The ion-pair formation ability was
suppressed due to the high concentration of salts in the sample solvents.
Consequently, the oligonucleotide was not properly retained, and part
of the peak was eluted as a split peak. On the other hand, simultaneous
co-injection of pure water resulted in increased peak areas for the fulllength
product (FLP), confirming that it effectively provided appropriate
peak retention. When the co-injection volume was 3 μL or more (Figure
3 (4), (5)), split peaks were no longer observed. The relationship between
the co-solvents, co-injection volumes, and the normalized peak areas
(%) of FLP is shown in Figure 4 (sample solvent : NaCl). Regardless of
the co-injected solvent type, the normalized peak areas of FLP remained
nearly constant when the co-injection volume was 3 μL or more. This
suggests that co-injection is effective in suppressing the peak splitting
phenomenon caused by the sample solvent effect.
Figure 3 Comparison of Chromatograms with/without Co-injection
(sample solvent : NaCl)
(5) NaCl_5uL_water_co-injection
(4) NaCl_3uL_water_co-injection
(3) NaCl_1uL_water_co-injection
(2) NaCl_without co-injection
(1) blank
0 5 10 15 20 min
(5)
(4)
(3)
(2)
(1)
AU
0
1.0
0.5
split peak FLP
split peak FLP
FLP
FLP
Figure 4 Normalized FLP Peak Areas (sample solvent : NaCl)
* normalization based on sum of all peaks including FLP related impurities
0
10
20
30
40
50
60
70
80
90
100
without co-injection
Water_1uL
Water_3uL
Water_5uL
100mM HFIP 10mM HA_1uL
100mM HFIP 10mM HA_3uL
100mM HFIP 10mM HA_5uL
100mM HFIP 30mM HA_1uL
100mM HFIP 30mM HA_3uL
100mM HFIP 30mM HA_5uL
100mM HFIP 50mM HA_1uL
100mM HFIP 50mM HA_3uL
100mM HFIP 50mM HA_5uL
%
Methods and Results
Table 1 Analysis Conditions
System : Nexera XS inert (Method Scouting System)
Column : Accura Triart Bio C18*1
(100 mm × 2.1 mm I.D., 1.9 μm)
Sample solvent 1 : 20 mM Tris-HCl (pH 8.5) containing 3 mol/L NaCl
Co-solvent 1 : Water
Co-solvent 2 : 100 mmol/L HFIP*2 and 10 mmol/L HA*3 in water
Co-solvent 3 : 100 mmol/L HFIP and 30 mmol/L HA in water
Co-solvent 4 : 100 mmol/L HFIP and 50 mmol/L HA in water
Co-injection volumes : 1, 3, 5 μL
Mobile phases
Pump A : 100 mmol/L HFIP and 10 mmol/L HA in water
Pump B : 100 mmol/L HFIP and 10 mmol/L HA in Methanol
Temperature : 60 °C
Injection volume : 1 μL
Flow rate : 0.2 mL/min
Time program (%B) : 25 % (0-2 min) → 67 % (26 min) →
100 % (26-27 min) → 25 % (27-35 min)
Detection : 260 nm (SPD-M40, UHPLC inert cell)
*1 YMC.CO., LTD.
*2 1,1,1,3,3,3-hexafluoro-2-propanol
*3 Hexylamine
14
• Oligonucleotides can be easily analyzed using a Nexera XS inert UHPLC
system and an LCMS-2050 single quadrupole mass spectrometer.
• The molecular weight of oligonucleotides can be estimated by
deconvoluting the obtained mass spectra.
benefits
Confirming Molecular Weight of 70-mer Synthetic DNA Sequences
Using a Single Quadrupole Mass Spectrometer
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
Methods and Results
Sample Single-stranded synthetic DNA
GGTGTCAGGCTCACGGACCACTGCACAACAATCCCACGACGT
CGCCATTTTCTGCGATCCGGCAAGGCGA
Concentration
and Quantity
10 pmol
Analysis The above oligonucleotide was analyzed using the analysis
conditions listed in Table 1.
Results The total ion chromatogram obtained from analyzing the
synthetic DNA is shown in Figure 1. Based on the mass spectrum
(Figure 2) of the peak detected near a retention time of 11
minutes, multi-charged ions with charge states from 17 to 22
were detected.
Deconvolution analysis for the multi-charged ions resulted in
calculating an estimated molecular weight of 21465.4 (Figure 3)
and a theoretical molecular weight of 21465.9 with a small mass
error level of 1 Da or less.
Conclusion
Generally, when estimating molecular weight using a deconvolution function, the more multiply-charged ions that can be obtained, the more reliable the
molecular weight estimation will be. As a result of deconvolution of the mass spectrum for the detected peaks, it was possible to estimate the molecular
weight of the principal components of the oligonucleotide therapeutic within a 1 Da margin of error from the theoretical value. The LCMS-2050 enables
fast and highly sensitive analysis across a wide mass range, while maintaining user-friendly operation similar to LC systems. The system described above
provides a useful analytical tool for quality control of oligonucleotide therapeutics.
<Acknowledgments>
We are grateful to Dr. Yuuya Kasahara (National Institutes of Biomedical Innovation, Health and Nutrition, Japan) for generously providing the sample.
Figure 1 TIC Chromatograms of the Synthetic DNA
Figure 3 Deconvoluted Mass Spectrum
0.0 2.5 5.0 7.5 10.0 12.5 min
0
10000000
20000000
30000000
40000000
50000000
60000000 TIC chromatogram
Table 1 Analysis Conditions
[HPLC conditions] (Nexera XS inert)
Column : Shim-pack Scepter Claris C18-120
(100 mm x 2.1 mm I.D., 1.9 μm)
Flow rate : 0.3 mL/min
Mobile phase A : 95.4 mM HFIP, 7.1 mM TEA in water
Mobile phase B : 95.4 mM HFIP, 7.1 mM TEA in methanol
Time program : 5 %B (0-2 min) - 35 %B (15 min) - 80 %B (16-17
min) - 5 %B (18-25 min)
Column temp. : 50 °C
Detection : PDA 200-400 nm
Injection volume : 2.33 μL (10 pmol)
[MS conditions] (LCMS-2050)
Ionization : ESI/APCI (DUIS), Negative mode
Interface voltage : -2.0 kV
Mode : Scan (m/z 600-2000)
Nebulizing gas flow : 2.0 L/min
Drying gas flow : 5.0 L/min
Heating gas flow : 7.0 L/min
Desolvation temp. : 450 °C
DL temp. : 200 °C
Figure 2 Mass Spectrum of the Synthetic DNA
z=22
z=21
z=20
z=19
z=18
z=17
15
Seamless Connectivity with Shimadzu LC Systems
The small footprint of the LCMS-2050 creates the flexibility to adapt to different needs. As with other LC detectors, It can be
integrated into any Shimadzu LC architecture whether it is a high-throughput analytical system, a preparative LC with fraction
collection, or even a legacy model.
Easy Parameter Settings for Seamless Operation
The LCMS-2050 enables analysis by configuring only simple parameter settings similar to a PDA detector. It can perform everything
from MS data acquisition to data analysis with an operating feel that is no different than using an LC unit.
Adding MS to Complement and Confirm Optical Detection
UV-PDA and MS are orthogonal technologies each having their own strengths. MS detectors are generally more sensitive than
optical detectors and, moreover, enable selective detection of compounds by their masses. For this reason, MS detectors can
detect co-eluting compounds as well as many analytes which do not respond to UV detection. The LCMS-2050 is a valuable
addition to any LC system to help increase reporting confidence.
Mass-it (Mass signature impartment technology)
Mass-it is a new invention for displaying mass information that helps scientists grasp complex data at a single glance. It detects
and overlays signature mass information onto the LC-UV or the LC-PDA chromatogram. This makes it possible to spot where there
are multiple components co-eluting in a single UV peak and where there are 'hidden' components without UV absorbance. All in
a single click, at a single glance. In addition, Mass-it includes functionality for suggesting when multiple components with
different masses are coeluted. This reduces the risk of overlooking unknown impurities that are difficult to separate.
Liquid Chromatograph Mass Spectrometer
LCMS-2050
Features
The LCMS-2050 single quadrupole mass spectrometer system offers a
combination of easy usability, high basic performance, and compact size,
which makes it easy to use as an LC detector while also ensuring the high
analytical capabilities of a mass spectrometer.
Equipped standard with DUIS heated ionization, it provides the benefits
of both ESI and APCI injection methods. The LCMS-2050 can measure
a wide range of target compounds, from small to large molecules and
from low to high polarity levels, making it suitable for a wide variety of
applications and fields.
LCMS-2050 with Nexera XS inert
UV Chromatogram for Atorvastatin
16
Simple Analysis of Impurities in Oligonucleotide Therapeutics
Using a Single Quadrupole Mass Spectrometer
• The molecular weights of oligonucleotides and related impurities can be
confirmed using an Nexera XS inert LC system and an LCMS-2050 single
quadrupole mass spectrometer.
• The LCMS-2050 can be used for simple analysis in the same manner as an
LC detector.
benefits
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
Molecular Weight Measurement of Drug Substances and Impurities
Methods and Results
Sample ・ FLP (20-mer sequence with theoretical molecular weight of 7169)
T*-mC*-T*-T*-G*-dG-dT-dT-dA-dCdA-
dT-dG-dA-dA-A*-T*-mC*-mC*-mC*
・n-1 (3’) 19-mer sequence with theoretical molecular weight of 6776)
T*-mC*-T*-T*-G*-dG-dT-dT-dA-dCdA-
dT-dG-dA-dA-A*-T*-mC*-mC*
・n-3 (3’) 17-mer sequence with theoretical molecular weight of 5987)
T*-mC*-T*-T*-G*-dG-dT-dT-dA-dCdA-
dT-dG-dA-dA-A*-T*
・n-10 (5’) 10-mer sequence with theoretical molecular weight of 3553)
dA-dT-dG-dA-dA-A*-T*-mC*-mC*-mC*
* = 2’-O-methoxyethyl, m = 5-methyl, d = 2’-deoxy
Concentration
and Quantity
FLP: 0.17 pmol/μL and 6 μL (equivalent to 1 pmol)
Analysis A sample prepared by mixing the four types of oligonucleotides
indicated above (including deletion variants equivalent to 5 % of
FLP) was analyzed using the measurement conditions in Table 1.
Results LabSolutions Insight Biologics software was used for data analysis.
The UV (260 nm) and component chromatograms obtained from
analyzing a model oligonucleotide measurement sample are shown in
Figure 1. The component chromatogram was obtained by combining the
spectra for different isotopes and all charge states based on MS1 spectra.
Peaks were confirmed for deletion variants n-10 (5’), n-3 (3’), and n-1 (3’),
and FLP, in that order.
Mass spectra for peaks derived from FLP and deletion variant n-1 (3’)
are shown in Figure 2. Multi-charged ions with 3 to 10 charges were
detected. Each mass spectrum was analyzed by multi-charged ion
analysis to estimate theoretical molecular weights (Figure 3). This resulted
in calculating a molecular weight of 7168 for FLP (7169 theoretical)
and 6775 for n-1 (3’) (6776 theoretical), which indicated peaks were
identified with a mass error level of 1 Da or less from theoretical values.
Table 1 Measurement Conditions
[HPLC conditions] (Nexera XS inert)
Column : Shim-pack Scepter Claris C18-300
(100 mm x 2.1 mm I.D., 1.9 μm)
Flow rate： 0.3 mL/min
Mobile phase A : 100 mmol/L HFIP, 10 mmol/L TEA in water
Mobile phase B : Methanol
Time program : 10 %B (0 min) → 35 %B (15 min)
→ 40 %B (20 min) → 90 %B (20.1-22 min)
→10 %B (22.1-26 min)
Column temp. : 60 °C
UV detection : 190-400 nm
Injection volume : 6 μL
[MS conditions] (LCMS-2050)
Ionization : ESI/APCI (DUIS), Negative mode
Interface voltage : -3.0 kV
Mode : Scan (m/z 550-2000)
Nebulizing gas flow : 3.0 L/min
Drying gas flow : 5.0 L/min
Heating gas flow : 7.0 L/min
Desolvation temp. : 450 °C
DL temp. : 200 °C
Conclusion
The LCMS-2050 single quadrupole mass spectrometer was used to analyze the
principal components and related impurities in model oligonucleotide samples.
Combining easy operation with excellent performance features makes the
Figure 2 Component Chromatogram from Model Oligonucleotide Analysis LCMS-2050 a useful tool for quality control of oligonucleotide therapeutics.
Figure 1 Chromatograms of Model Oligonucleotide (A) UV Chromatogram, (B) TIC Chromatogram
Figure 3 Mass Spectra for FLP and n-1 (3’)
1:TIC(-) 8.57e5 Figure 4 Deconvolved Mass Spectra
N-10(A11:C20) N-1(T1:C19)
FLP(T1:C20)
8.0 8.5 9.0 9.5 10.0 10.5 11.0 11.5 12.0
0.00
%
100.00
N-3(T1:T17)
(B)
PDA - Ch1: 260nm,4nm 3.90e4
8.0 8.5 9.0 9.5 10.0 10.5 11.0 11.5 12.0
0.0e0
1.0e4
2.0e4
3.0e4
4.0e4 (A)
1:TIC(-) 8.57e5
N-10(A11:C20) N-1(T1:C19)
FLP(T1:C20)
8.0 8.5 9.0 9.5 10.0 10.5 11.0 11.5 12.0
0.00
%
100.00
N-3(T1:T17)
(B)
1:MS(-) retention time: [11.148-11.695] 2.41e5
716
733
796
798
895
1023
600 800 1000 1200
0.0e0
5.0e4
1.0e5
1.5e5
2.0e5
1:MS(-) retention time: [10.968-11.148] 3.71e4
677
752
846
927
600 800 1000 1200
0.0e0
5.0e3
1.0e4
1.5e4
2.0e4
2.5e4
3.0e4
3.5e4 FLP [M-9H]9- n-1 (3’)
[M-10H]10-
[M-8H]8-
[M-7H]7-
[M-7H]7-
[M-8H]8-
[M-9H]9-
[M-10H]10-
#15 FLP (T1:C20): MS spectrum from multi-charged ion analysis [M-H]-
7168
7100 7200
0.0e0
1.0e6
2.0e6
3.0e6
4.0e6
#14 N-1 (T1:C19): MS spectrum from multi-charged ion analysis [M-H]-
6775
6700 6800 6900
0.0e0
1.0e5
2.0e5
3.0e5
4.0e5
5.0e5
6.0e5 n-1 (3’) FLP
#15 FLP (T1:C20): MS spectrum from multi-charged ion analysis 7168
7100 7200
0.0e0
1.0e6
2.0e6
3.0e6
4.0e6
#14 N-1 (T1:C19): MS spectrum from multi-charged ion analysis [M-H]-
6775
6700 6800 6900
0.0e0
1.0e5
2.0e5
3.0e5
4.0e5
5.0e5
6.0e5 n-1 (3’)
17
Int. x100,000
[M-7H]7-
1017.20 [M-6H]6-
1186.81
[M-5H]5-
1424.48
[M-4H]4-
1780.79
[M-8H]8-
889.99
750 1000 1250 1500 1750 m/z
0.00
0.50
1.00
1.50
Int. x10,000
7127.18
7000 7050 7100 7150 7200 7250 m/z
0.0
2.5
5.0
7.5
Note: The images are for illustrative purposes only.
Features
Wide Mass Range
With a wide mass range from m/z 2 to 2,000, the LCMS-2050 can be used
for a broad range of applications. By using LabSolutions LCMS functionality
for multi-charged ion analysis, the molecular weights of large molecules can
also be estimated.
Nusinersen Mass Spectrum and Deconvolution Results
When the LCMS-2050 was used to measure nusinersen (theoretical
molecular weight: 7127.23), ions with 4 to 8 charges were detected.
The molecular weight calculated using the multi-charged ion analysis
functionality was an extremely accurate 7127.18, which differs from the
theoretical molecular weight by only 0.05 Da. In general, when estimating
molecular weight values using multi-charged ion analysis functionality, the
more multi-charged ions detected, the higher the reliability of estimated
molecular weight values. The broad mass range of the LCMS-2050 means
the system can also be used to analyze not only nucleic acids, but also
peptides, proteins, polymers, and other large molecules.
LabSolutions Insight Biologics Oligonucleotide Characterization Software Enables Data Analysis
LabSolutions Insight Biologics can be used to easily identify target substances and impurities by selecting a nucleic-acid base,
linker, ribose, modification, or other structure and creating a sequence.
Liquid Chromatograph Mass Spectrometer
LCMS-2050
LCMS-2050
18
Analysis of Oligonucleotide Impurities Using Single
Quadrupole Mass Spectrometer
Oligonucleotide Synthesis
Scaling Up
Quality Control
• Combination use of LCMS-2050 single quadrupole mass spectrometer and
LabSolutions Insight Biologics provides comprehensive characterization of
oligonucleotides and related impurities.
• Purity calculations for target components can be performed even on poorly
separated peaks by utilizing MS spectra simultaneously acquired with UV
chromatogram.
benefits
Introduction
In quality control process, the use of a single quadrupole mass spectrometer is expected to be advantageous because of providing mass information with
easy operation when impurity information is already known. This article presents a simulated impurity analysis of synthetic oligonucleotide using the
LCMS-2050 high-performance liquid chromatography-mass spectrometer and LabSolutions Insight Biologics.
Analytical Conditions
The employed instrument setup was Nexera XS inert and LCMS-2050. HPLC conditions are shown in Table 2, and MS conditions are shown in Table 3.
The conditions were set where n-1(5') co-eluted with FLP, while n-3(5') was separated (Figure 1) to demonstrate impurity analysis performance.
Data processing parameters
In LC-MS, even an isolated single component may be detected at different m/z due to differences in valence or isotopes. Insight Biologics can
combine peaks originated from different valences or isotopes into a single component chromatogram to be displayed. In this article, the peak areas
of respective components are calculated using the following formula.
Table 1 Sequence information for respective components*
Abbreviations Sequence (5’ → 3’)
FLP MG-MC-MC-MU-MC-dA-dG-dT-dT-dC-dT-dG-dCdT-
dC-MG-MC-MA-MC-MC
n-1(5’) MC-MC-MU-MC-dA-dG-dT-dC-dC-dT-dG-dC-dTdC-
MG-MC-MA-MC-MC
n-3(5’) MU-MC-dA-dG-dT-dC-dT dG-dC-dT-dT-dT-dC-MGMC-
MA-MC-MC
* Positions 5 of M: 2‘-O-(2-methoxyethyl) nucleoside; d: 2’-deoxynucleoside; C: cytosine, and
U: uracil are substituted by methyl groups. All phosphodiester bonds between nucleotides
have been substituted by phosphorothioate bonds.
Table 2 HPLC analytical conditions
System : Nexera XS inert
Column : Shim-pack Scepter Claris C18-120 (100 mm ×
2.1 mm I.D., 1.9 μm)*1
Mobile Phase A : 100 mmol/L HFIP, 10 mmol/L TEA in water
Mobile Phase B : 100 mmol/L HFIP, 10 mmol/L TEA in methanol
Time Program : 15 % B (0 min) → 30 % B (6 min)
→ 45 % B (6.1-8 min) → 15 % B (8.1-11 min)
Flow Rate : 0.4 mL/min
Column temp. : 60 °C
Injection volume : 5 μL
UV Detection : 190-800 nm (photodiode array detector)
*1 P/N : 227-31210-02
Table 3 MS detection conditions
Ionization : ESI/APCI (DUIS), Negative mode
Mode : Scan (m/z 650-2000)
Nebulizing gas flow : 3.0 L/min
Drying gas flow : 5.0 L/min
Heating gas flow : 7.0 L/min
Desolvation temp. : 500 °C
DL temp. : 250 °C
Interface voltage : -3.0 kV
Figure 1 Chromatograms of FLP, n-1(5’), and n-3(5’) (260 nm by PDA detector)
4 4.5 5 5.5 6 6.5 min
0
200
400
600
800
1000
mV
Black：FLP
Magenta：n-1(5’) molecule
Blue：n-3(5’) molecule
Component peak area = peak area in UV chromatogram
× MS peak area of target component involved in UV−corresponding peak
Sum of MS peak areas of all components involved in UV−corresponding peak
19
Conclusion
The simulated sample consisting of mainly FLP and small amounts of n-1(5')/n-3(5') was analyzed using the LCMS-2050 and LabSolutions Insight
Biologics software and obtained data were processed appropriately. Detection, identification, and quantitation at low concentrations were accomplished
not only for n-3(5') well-separated from FLP but also for n-1(5') co-eluted with FLP. In case that establishing analytical conditions is difficult, Using this
instrument setup and software will provide efficient quality confirmation of oligonucleotide therapeutics.
<Acknowledgments>
A part of this work was supported by AMED under Grant Number JP21ae0121022, JP21ae0121023, JP21ae0121024 (Project leader: Satoshi Obika).
Quantitation od impurities in FLP
The linearity of the component peak area and concentration of FLP was confirmed using LabSolutions Insight Biologics. The results showed a coefficient
of determination of 0.999 or higher over the range of 1, 5, 10, 25, and 50 μmol/L. Next, samples were prepared and analyzed by adding each
nucleotide-deficient to FLP at 20 μmol/L, which was within the linearity range. Both nucleotides-deficient of n-1(5') and n-3(5') were detected and
identified when added at 0.25% or more relative to FLP (equivalent to an added concentration of 0.05 μmol/L). Figure 2 shows the UV chromatogram
and component chromatogram for n-1(5') added at 0.25% relative to FLP. Figure 3 and 4 show the results of multivalent ion data processing.
The concentrations of each nucleotide-deficient contained in FLP and obtained component peak areas showed good linearity with a contribution rate of
0.999 or higher over the above addition concentration range (0.25, 0.5, 1, 2, 5%) as shown in Figure 5.
Figure 3 Result of multivalent ion data processing for FLP containing 0.25% of
n-1(5’) (n-1(5’) shown in Figure 2)
Upper : MS spectrum of multivalent ion data processing
Lower : MS spectrum
拡大図
N-N1-(1C(2C:2C:2C02)0)
Figure 2 Chromatograms of FLP containing 0.25% of n-1(5’)
4.5 5.0 5.5 6.0 6.5
0.0e0
1.0e4
2.0e4
7 min
N-1(C2:C20)
4.5 5.0 5.5 6.0 6.5
2.89
%
3.67
7 min
PDA chromatogram
PDA 260 nm
MS chromatograms
Mass chromatograms for FLP and
product related impurities
Figure 4 Result of multivalent ion data processing for FLP containing 0.25% of n-1(5’) Identification result
Figure 5 Linearity evaluation for additional concentration
y = 22401x + 11962
r² = 0.9999
0
50
100
150
0 2 4 6
n-1(5’)
(%)
(component peak area)
(×1000)
y = 24174x + 7182.2
r² = 0.9994
0
50
100
150
0 2 4 6
n-3(5’)
(%)
(component peak area)
(×1000)
20
Efficient optimization to separate oligonucleotides
by Reversed-Phase Ion-Pair Chromatography
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
• Using LabSolutions MD software can significantly reduce the labor requirements for
developing LC methods, such as for screening mobile phases or evaluating various parameters.
• An AI algorithm can optimize gradient conditions, regardless of the operator skill level.
• Useful for evaluating optimal conditions for separating oligonucleotide solutions
that include impurities, such as sequences with different chain lengths.
benefits
Methods and Results
Sample Synthetic oligonucleotides with a series of thymine bases.
11 types (HPLC grade purity) with different chain lengths (The “x”
in dT(x) indicates the number of bases.)
(dT(6), (10), (15), (16), (17), (18), (19), (20), (25), (30), and (40))
Concentration
and Quantity
5 μmol/mL
Pretreatment Dissolve the sample in water to prepare the concentrations indicated
above.
Separation Condition Optimization Process
1. Screening Ion-pair reagent types and concentrations
Organic solvent types
2. Evaluating Conditions Column oven temperature and mobile phase pH levels
evaluated
3. Optimization Gradient conditions
Parameters Considered
Sample Mixture solution of 7 sequences (dT(6), (10), (15), (20), (25), (30),
and (40))
Measurement
Conditions
Ion-pair reagents were prepared using an aqueous acetic acid
solution to adjust the pH of triethylamine (TEA), dibutylamine (DBA),
and hexylamine (HA). Acetonitrile and methanol were used as
organic solvents.
18 combinations of ion-pair reagents with different concentrations
and organic solvents were evaluated using the analysis conditions
listed in Table 1.
Results Using TEA as the ion-pair reagent resulted in multiple coeluted
peaks, regardless of the organic solvent combination (Figure 1).
However, using DBA or HA improved separation. Both DBA and HA
showed a tendency for separation to improve as the concentration
was increased, but particularly HA showed a tendency to become
more difficult to dissolve during preparation the higher its
concentration.
Table 1 Analysis Conditions
System : Nexera XS inert
Column : Shim-pack Scepter Claris C18-120
(100 mm × 2.1 mm I.D., 3 μm) *1
Mobile phase A : ① 20/50/100 mmol/L TEA acetic acid aqueous
solution pH6.5
② 5/20/50 mmol/L DBA acetic acid aqueous
solution pH6.5
③ 20/50/100 mmol/L HA acetic acid aqueous
solution pH6.5
Mobile phase B : Acetonitrile or Methanol
Flow rate : 1.0 mL/min
B Conc. : ① TEA：10-50 %(0-8 min) →
100 %(8.01-11 min) → 10 %(11.01-15 min)
② DBA：20-70 %(0-8 min) →
100 %(8.01-11 min) → 20 %(11.01-15 min)
③ HA：20-80 %(0-8 min) →
100 %(8.01-11 min) → 20 %(11.01-15 min)
Column temp. : 40 °C
Flow rate : 0.35 mL/min
Injection volume : 5 μL
Detection : UV 260 nm (SPD-M40, UHPLC inert cell)
Vial : TORAST-H Glass Vial*2
*1 P/N: 227-31210-05, *2 P/N: 370-04300-01 (Shimadzu GLC Ltd.)
Step 1: Initial Mobile Phase Screening
Alkylamine (type and
concentration)
Methanol/acetonitrile
mixture ratio
Figure 1 Chromatogram from Mixture Sample of 7 Oligonucleotide Components
Mobile Phase B: (A) Acetonitrile, (B) Methanol
2.0 3.0 4.0 5.0 6.0 7.0 min
■ Peaks
1. dT(6) 5. dT(25)
2. dT(10) 6. dT(30)
3. dT(15) 7. dT(40)
4. dT(20)
TEA 20 mmol/L
TEA 50 mmol/L
TEA 100 mmol/L
DBA 5 mmol/L
DBA 20 mmol/L
DBA 50 mmol/L
HA 20 mmol/L
HA 50 mmol/L
HA 100 mmol/L
4.0 5.0 6.0 7.0 8.0 9.0 10.0 11.0min
1 2 3
45
6 7
(B) Methanol
TEA 20 mmol/L
TEA 50 mmol/L
TEA 100 mmol/L
DBA 5 mmol/L
DBA 20 mmol/L
DBA 50 mmol/L
HA 20 mmol/L
HA 50 mmol/L
HA 100 mmol/L
1 2 3 4 5 6 7
(A) Acetonitrile
21
Parameters Considered
Parameters Considered
Functionality for Using AI to Automatically Optimize Gradient Conditions
Sample Mixture solution of 7 sequences (dT(6), (10), (15), (20), (25), (30), and (40))
Measurement
Conditions
Analysis conditions were further evaluated using 50 mmol/L DBA
and 50 mmol/L HA as mobile phase A and using acetonitrile and
methanol as the organic solvent. The gradient program was fixed as
condition (2) in Table 1, whereas the column oven temperature was
varied to 40, 50, 60, 70, and 80 °C and the mobile phase A pH level
was varied to 6.0, 6.5, 7.0, and 7.5. The analysis batch was created
and analyzed to comprehensively evaluate each combination.
Since the retention time for each component varied significantly
depending on parameter changes or organic solvent differences, the
peak tracking functionality in LabSolutions MD was used to identify
respective peaks. Due to the small differences between UV spectra
for nucleic acid sequences, the information was not suited for
identification. Instead, the elution order was used for identification.
Results A design space was created with the pH of mobile phase A on the
vertical axis and column oven temperature on the horizontal axis in
order to visualize areas (Figure 2) where separation is at least 1.5 (or
at least 1.2 only for combinations of HA and methanol). The black
dots indicate measurement points, red areas indicate areas with
high separation, and blue areas indicate low separation. In terms
of the mobile phase pH level, the results suggest that different
conditions are optimal depending on the organic solvent. In terms
of column oven temperature, the results indicate that separation
tends to increase the higher the temperature, regardless of the ionpair
reagent and organic solvent combination.
Sample Sample containing a mixture of 11 oligonucleotide sequences with
different chain lengths (dT(6), (10), (15) to (20), (25), (30), and (40))
Measurement
Conditions
Results were automatically searched to determine optimal gradient
conditions that result in a minimum separation of 1.5. The organic
solvent setting was fixed at methanol and the column oven
temperature fixed at 80 °C.
An AI algorithm was used to repeatedly perform corrected analyses
based on two condition settings for mobile phase A (50 mmol/L DBA
at pH 7.5 and 50 mmol/L HA at pH 7.5) in order to automatically
search for gradient conditions that result in a minimum separation
of 1.5 for respective mobile phase conditions. The resulting
chromatograms after optimization are shown in Figure 4.
Results Eventually, the respective mobile phase conditions were used
to automatically search for gradient conditions that result in a
minimum separation of 1.5. The resulting chromatograms after
optimization are shown in Figure 4.
Step 2: Optimization of Mobile Phase pH and Oven Temperature
Step 3: Automatic Optimization of Gradient Conditions
Mobile phase pH
Gradient conditions
Column oven temperature
Figure 2 Design Space for Minimum Separation of 7 Oligonucleotide Components in Mixture Sample
Figure 4 Chromatograms from Mixture Sample of 11 Oligonucleotide Components Using
Automatically Searched Conditions
Mobile Phase A: (A) 50 mmol/L DBA pH 7.5
(B) 50 mmol/L HA pH 7.5
■ Peaks
1. dT(6) 5. dT(17) 9. dT(25)
2. dT(10) 6. dT(18) 10. dT(30)
3. dT(15) 7. dT(19) 11. dT(40)
4. dT(16) 8. dT(20)
3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 min
10
20
30
40
50
60
70
80
90
%
B.Conc
1
2 3 4 5 6 7 8
9
10
11
2.5
3.0 3.5 4.0 4.5 5.0 5.5 6.0 6.5 7.0 min
10
20
30
40
50
60
70
80
90
%
B.Conc
1
2 3 4 5 6 7 8
9
10
11
(A) DBA
(B) HA
2.5
Initial
analysis
Condition
search
Correction
analysis
Optimization
of conditions
AI repeatedly analyzes samples to
automatically search for conditions
with no human intervention
Initial
setting
Conclusion
A standard mixture sample of 11 sequences with different chain lengths was used as a model sample for evaluating separation conditions for reverse-phase ion
pair chromatography.
Using LabSolutions MD enabled a comprehensive evaluation of ion-pair reagent, mobile phase pH, and column oven temperature settings. Furthermore, visually
showing the results was helpful for efficiently identifying optimal conditions. Furthermore, using the LabSolutions MD functionality for automatically optimizing
gradient conditions, gradient conditions that satisfied the minimum 1.5 separation criterion were found within a few hours, which significantly reduced the
amount of labor normally required for that process.
Figure 3 shows the LabSolutions MD process flow for automatically
optimizing gradient conditions. LabSolutions MD includes a proprietary AI
algorithm that can repeatedly make improvements to gradient conditions
(condition search) and then analyze samples based on those corrected
conditions (corrected analysis) to automatically search for conditions that
satisfy separation requirements.
Figure 3 Automated Work ow of Gradient Optimization with LabSolutions MD
22
Efficient Method Development of Oligonucleotides
by Reversed-Phase Ion-Pair Chromatography
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
• LabSolutions MD can improve the efficiency of method development for
oligonucleotides and related impurities.
• LCMS-2050 single quadrupole mass spectrometer can accurately track each
peak of oligonucleotides and related impurities.
• Nexera XS inert (UHPLC system) with Shim-pack Scepter Claris (inert-coating
metal-free column) offers complete inertness of the sample flow path to
achieve optimal chromatographic separation of oligonucleotides.
benefits
Step 1: Initial Screening for Analysis Method Parameters Considered
Alkylamine concentration
Methanol/acetonitrile
mixture ratio
Table 1 Sequences of Oligonucleotide and Related Impurities HFIP concentration
Name Sequence (5’→3’) Length
FLP T*-mC*-T*-T*-G*-dG-dT-dT-dA-dC-dA-dT-dGdA-
dA-A*-T*-mC*-mC*-mC*
20 mer
n-1(3’) T*-mC*-T*-T*-G*-dG-dT-dT-dA-dC-dA-dT-dGdA-
dA-A*-T*-mC*-mC*
19 mer
n-1(5’) mC*-T*-T*-G*-dG-dT-dT-dA-dC-dA-dT-dG-dAdA-
A*-T*-mC*-mC*-mC*
19 mer
n-3 T*-G*-dG-dT-dT-dA-dC-dA-dT-dG-dA-dA-A*-
T*-mC*-mC*-mC*
17 mer
n+1 T*-T*-mC*-T*-T*-G*-dG-dT-dT-dA-dC-dA-dTdG-
dA-dA-A*-T*-mC*-mC*-mC*
21 mer
PO FLP (modified from phosphorothioate to phosphate
diester at 5’)
20 mer
* = 2’-O-methoxyethyl m = 5-methyl d = 2’-deoxy, PS(full)
Table 2 Analytical Conditions for Initial Screening
System : Nexera XS inert (Method Scouting System)
Column : Shim-pack Scepter Claris
(100 mm × 2.1 mm I.D., 3 μm) *1
Temperature : 60 °C
Injection volume : 2 μL
Mobile phases
Pump A – Line A :
100 mmol/L HFIP*2 and 20 mmol/L TEA*3 in
water
– Line B : 100 mmol/L HFIP in water
– Line C : 200 mmol/L HFIP and 20 mmol/L TEA in water
– Line D : 200 mmol/L HFIP in water
Pump B – Line A : Acetonitrile
– Line B : Methanol
Flow rate : 0.4 mL/min
Time program (%B) : 6 % (0 min) →24 % (36 min)→
50 % (36-37 min) →6 % (37-46 min)
Detection : 260 nm (SPD-M40, UHPLC inert cell)
System : LCMS-2050
Ionization : ESI/APCI (DUIS), negative mode
Mode : SCAN (m/z 500-2000)
Nebulizing gas : 2.0 L/min (N2)
Drying gas : 5.0 L/min (N2)
Heating gas : 7.0 L/min (N2)
DL temp. : 200 °C
Desolvation temp. : 450 °C
Interface Voltage : -2.0 kV
*1 P/N : 227-31210-05 (Shimadzu GLC product number)
*2 1,1,1,3,3,3-hexafluoro-2-propanol
*3 Triethylamine
Figure 1 Chromatograms Obtained by Mobile Phase Screening 100 mmol/L HFIP (Upper)
5 10 15 20 25 30 min
mAU
⑪ 100mM HFIP 20mM TEA/ACN 50%_MeOH 50%
⑩ 100mM HFIP 20mM TEA/ACN 100%_MeOH 0%
⑨ 100mM HFIP 15mM TEA/ACN 0%_MeOH 100%
⑧ 100mM HFIP 15mM TEA/ACN 50%_MeOH 50%
⑦ 100mM HFIP 15mM TEA/ACN 100%_MeOH 0%
⑥ 100mM HFIP 10mM TEA/ACN 0%_MeOH 100%
⑤ 100mM HFIP 10mM TEA/ACN 50%_MeOH 50%
④ 100mM HFIP 10mM TEA/ACN 100%_MeOH 0%
③ 100mM HFIP 5mM TEA/ACN 0%_MeOH 100%
② 100mM HFIP 5mM TEA/ACN 50%_MeOH 50%
① 100mM HFIP 5mM TEA/ACN 100%_MeOH 0%
⑫ 100mM HFIP 20mM TEA/ACN 0%_MeOH 100%
①①
②
③
③
⑥⑥
⑤
④
④
⑪⑪
⑩
⑨
⑧
⑦
⑦
⑫ 0
100
200
300
400
500
600
700
23
Step 2: Optimization of Analysis Method Parameters Considered
Initial gradient
concentration
Column oven
temperature
Acetonitrile
concentration in
organic mobile phase
Automated Peak Tracking by LCMS-2050 Design Space Evaluation for Optimal Condition
Chromatogram at Optimal Condition
10 12 14 16 18 min
mAU
0
100
200
10 12 14 16 18 min
mAU
0
100
200
n-3
* 5985
n-1(5’)
* 6772
n-1(3’)
* 6773
PO
* 7151
FLP
* 7167
n+1
* 7561
ACN 50%_MeOH 50%/Oven Temp 60/initial Conc. 8%
* Estimated molecular weights by deconvolution
ACN 60%_MeOH 40%/Oven Temp 60/initial Conc. 8%
Acetonitrile Ratio (%)
60
50
40
Oven Temp (℃)
55 60 65
7.8
6.8
5.8
4.8
3.8
Resolution of n-3 and n-1(5’)
Acetonitrile Ratio (%)
60
50
40
Oven Temp (℃)
55 60 65
0.53
0.41
0.30
0.18
0.07
Resolution of n-1(5’) and n-1(3’)
Acetonitrile Ratio (%)
60
50
40
Oven Temp (℃)
55 60 65
1.00
0.78
0.55
0.33
0.10
Resolution of n-1(3’) and PO
Acetonitrile Ratio (%)
60
50
40
Oven Temp (℃)
55 60 65
1.40
1.33
1.25
1.18
1.10
Resolution of PO and FLP
Resolution of n-1(3’) and PO < 0.7
A
Acetonitrile Ratio (%) 60
50
40
Oven Temp (℃)
55 60 65
Optimum condition that maximizes
resolution of n-1(5’) and n-1(3’)
Maximum retention time > 16
mAU
0
50
100
150
11 12 13 14 15 min
ACN 54%_MeOH 46%/Oven Temp 65/initial Conc. 8%
n-3
n-1(5’)
*7.4
n-1(3’)
*0.44 PO
*0.81
FLP
*1.4
n+1
*3.5
* Resolution
Figure 2 LC Chromatograms Obtained with 60 °C Column Oven Temperature, 8 % Initial
Concentration, and 50 % (upper) or 60 % (lower) Acetonitrile Ratio (Dashed lines indicate impurity
tracking based on molecular weight)
Figure 3 Design Space for Resolution of FLP and Related Impurities
(Initial concentration is 8 %.)
Figure 5 Overlay of Design Spaces of Resolution and Retention Time of
Last Eluting Peak
Figure 4 Chromatogram at Optimal Condition
(100 mmol/L HFIP and 10 mmol/L TEA)
Conclusion
The separation pattern of oligonucleotides is different depending on the concentration of HFIP and TEA in the aqueous mobile phase, the ratio of acetonitrile
and methanol in the organic solvent, column oven temperature, and initial concentration of gradient program. The separation behavior can differ based on
the structure of the oligonucleotide such as length, nucleobase, and the presence of modifications. Therefore, it is required to optimize the separation for each
sequence of the oligonucleotide individually. On the other hand, a number of analyses and data processing for the optimization of analytical conditions is a timeconsuming
challenge. LabSolutions MD can automate the entire workflow, including the generation of an analysis schedule, the mobile phases preparation, and
the data processing thanks to specific functionalities such as automated peak tracking, ranking of chromatograms by Evaluation Value, and design space. As this
article describes, the combination of LabSolutions MD, Nexera XS inert, Shim-pack Scepter Claris, and LCMS-2050 strongly improves the efficiency of the overall
workflow of method development for oligonucleotides.
24
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
An Oligonucleotide Impurity Analysis Workflow Using
LabSolutions Insight Biologics Software
Determining the Sequence of Drug Substances and Impurities
• The LCMS-9050 can be used with LabSolutions Insight Biologics data
analysis software for sequencing oligonucleotides and impurities.
• All impurities can be comprehensively identified, including oligonucleotide
user-specified modifications.
• The fragment coverage window in LabSolutions Insight Biologics makes it
easy to determine the locations of deletions or modifications.
benefits
Methods and Results
Sample 20-mer oligonucleotide crude product with phosphorothioate
modification
Sequence: CTG CTA GCC TCT GGA TTT GA
Monoisotopic mass: 6399.5998
Analysis The sample was analyzed based on the analysis conditions listed
in Table 1.
Analysis Software LabSolutions Insight Biologics
Results A comprehensive identification of all impurities in the MS1 data
obtained resulted in finding over 30 impurities, such as chain
length differences, base deletion variants, and ion adducts (Figure
1). Multi-charged ion analysis results for the PS20-mer peak are
shown in Figure 2. The spectra of impurities were also similarly
analyzed by multi-charged ion analysis in order to search for the
impurities.
Sequence coverage was checked for principal components and
impurities with a deletion at 14 nucleotides from the 5’ terminal
(present in 0.5 % of principal components) based on fragment
spectra obtained from MS2 data. This confirmed a high coverage
rate (Figure 3).
Table 1 Analysis Conditions
[HPLC conditions] (Nexera XS inert)
Column : Shim-pack Scepter Claris C18-120,
100 mm x 2.1 mm I.D., 1.9 μm
Mobile phase A : Aqueous solution of 100 mM HFIP and 10 mM TEA
Mobile phase B : 50 % Methanol solution of 50 mM HFIP and 5 mM
TEA
Gradient program : 5 %B (0-1 min)→ 40 %B (26 min)
→ 90 %B (26.1-30 min) → 5 %B (30.1-34 min)
Column temp. : 60 °C
Injection volume : 2 μL
[MS conditions] (LCMS-9050)
Ionization : ESI (Negative mode)
Mode : MS scan (m/z 550~2500), DDA
Interface voltage : -3.0 kV
Nebulizing gas flow : 3.0 L/min
Drying gas flow : 10.0 L/min
Heating gas flow : 10.0 L/min
DL temp. : 250 °C
Block heater temp. : 400 °C
Interface temp. : 350 °C
Conclusion
LabSolutions Insight Biologics software can comprehensively characterize and identify the sequences of oligonucleotide impurities.
The analysis workflow described in this article achieved complete sequence coverage not only for the main sample component, but also for an impurity with a
relative abundance of 0.5 % compared with the main component.
Figure 1 Component Chromatogram
Figure 2 Multi-Charged Ion Analysis Results
Upper: Multi-Charged Ion Analysis Spectrum; Middle: Mass Spectrum; Lower: Identification Results
Figure 3 Sequence Coverage
Upper: Principal Components; Lower: Impurities with Deletion at 14 Nucleotides from the 5’ Terminal
25
Sample information Chromatogram information Compound table
Mass spectrum
Structural assignment display
Mass spectral information
Data analysis results (assignment, analysis, and formula prediction)
Mass chromatogram
Quadrupole Time-of-Flight Liquid Chromatograph Mass Spectrometer
LCMS-9050
Features
The LCMS-9050 is a QTOF mass spectrometer designed for reliable and easy acquisition of accurate
masses in real laboratory settings.
Trusted mass accuracy
Shimadzu’s proprietary high-accuracy temperature control system suppresses even tiny mass
variations caused by external factors, ensuring accurate mass measurements without the operator
worrying about mass calibration.
Ultra-stable polarity switching
Reliable high-speed positive-negative polarity switching technology enables simultaneous analysis of
both positive and negative ions and contributes to the development of new applications and more
efficient analysis.
LabSolutions Insight Explore
Software for Supporting Everything from Qualitative to Quantitative Analysis
Explore software not only facilitates quantitative analysis of a large number of samples, but also comes with features for reliable library searching,
elucidation of compound structure and sample composition, and multivalent ion analysis, making full use of MS data with high resolution and mass
precision.
Multivalent Ion Analysis (Deconvolution)
For the deconvolution of multiple charge state envelopes produced by large molecules, such as proteins and oligonucleotides,
LabSolutions Insight Explore CSD (option) includes “ReSpect”. This multivalent ion analysis algorithm from Positive Probability Ltd
detects group(s) of multi-charged peaks and calculates the mass of the original species.
26
Reversed-Phase Ion-Pair LC/MS Analysis of siRNA under
Denaturing and Non-Denaturing Conditions
Oligonucleotide Synthesis
Scaling Up
Characterization and Quality Control
• The LCMS-9050 quadrupole time-of-flight mass spectrometer can be used
to characterize siRNA.
• The elution of siRNA in double-stranded (non-denatured) or single-stranded
(denatured) state can be confirmed by changing the column temperature.
• The LabSolutions Insight Biologics analysis software enables analysis of
multiple oligonucleotide sequences at once.
benefits
Samples
Double-stranded siRNA annealed with sense and antisense
strands of the following sequenceswas used.
Sense:
G-Um-A-A-Cm-Cm-A-A-G-A-G-Um-A-Um-Um-Cm-Cm-A-Um-dT-dT
Antisense:
A-U-G-G-A-A-Um-A-C-U-C-U-U-G-G-U-Um-A-C-dT-dT
(d: 2'-deoxy and m: 5-methyl)
Configuring the Data Analysis
Parameters
LabSolutions Insight Biologics can analyze multiple sequences. As an
example, in Figure 1, the sequences of sense and antisense strands were
set as analysis targets. The specified sequences and optionally added
information about nucleobases, linkers, riboses, and base modifications
can be saved as an analysis settings file.
Analytical Conditions
Analysis was performed with Nexera XS inert UHPLC and LCMS-9050
quadrupole time-of-flight mass spectrometer systems. The analytical
conditions are shown in Table 1.
Table 1 Analysis Conditions
UHPLC (Nexera XS inert)
Column : Shim-pack Scepter Claris C18-300*1
(100 mm x 2.1 mm I.D., 1.9 μm, )
Mobile Phase A : 100 mM HFIP, 10 mM TEA - water
Mobile Phase B : 100 mM HFIP, 10 mM TEA - methanol
Gradient Program : B Conc. 5 % (0 min) - 50 % (10 min) - 90 %
(10.01-12 min) - 5 % (12.1-25 min)
Flowrate : 0.3 mL/min
Column Temp. : 25 or 60 °C
Injection Volume : 1 μL
*1: P/N 227-31209-02
MS (LCMS-9050)
Ionization : ESI negative
Mode : MS m/z 550-2500
Nebulizing Gas Flow : 2.0 L/min
Drying gas Flow : 10.0 L/min
Heating gas Flow : 10.0 L/min
Interface Temp. : 350 °C
DL Temp. : 250 °C
Block Heater Temp. : 400 °C
Figure 1 Example of Multiple Sequence Settings
27
Separation of siRNA under
Denaturing and
Non-Denaturing Conditions
The UV chromatograms of sense, antisense, and doublestranded
siRNA are shown in Figure 2. The sense and antisense strands were
eluted at different retention times at both 60 and 25 °C column oven
temperatures. At a 60 °C column oven temperature, double-stranded
siRNA was detected as denatured and dissociated into sense and
antisense strands. On the other hand, at a 25 °C column temperature,
doublestranded siRNA was eluted at a retention time of 7.5 minutes,
which was slower than that of sense and antisense strands. In addition,
the peak of the sense strand, which seemed to remain without forming a
duplex during annealing, was also observed.
Results of Identification by LC/MS
Figure 3 shows the component chromatograms obtained by LC/MS analysis of double-stranded siRNA. In Insight Biologics, the identified oligonucleotide
sequence is displayed as a component chromatogram based on the MS1 spectrum and summed with different valences and isotopes. The sense strand
and antisense strand sequences were identified at both column temperatures of 60 °C and 25 °C.
Conclusion
LC/MS analysis of siRNA under denaturing and non-denaturing elution conditions was performed using an LCMS-9050 quadrupole time-of-flight mass
spectrometer. Under denaturing conditions at a column temperature of 60 °C, siRNA was eluted in a dissociated single-stranded state, but at a column
temperature of 25 °C, siRNA was eluted in a double-stranded state. By using the oligonucleotide analysis software LabSolutions Insight Biologics,
multiple nucleic acid sequences can be analyzed at the same time.
<Acknowledgments>
This research was supported by AMED under Grant Number JP21ae0121022, JP21ae0121023, JP21ae0121024 (Project leader: Satoshi Obika).
Figure 2 UV Chromatograms (260 nm) of the Sense Strand, Antisense Strand and Duplex siRNA
Top: With 60 °C Column Oven Temp.; Bottom: With 25 °C Column Oven Temp.
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 min
0
100000
200000
300000
400000
500000
600000
uV
Sense
Antisense
Duplex
Sense
Antisense
Duplex
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 min
0
100000
200000
300000
400000
500000
uV
Figure 3 Component Chromatograms of Duplex siRNA (Results of Identification by LC/MS)
Left: With 60 °C Column Oven Temp.; Right: With 25 °C Column Oven Temp.
Column Oven Temp: 60 °C
1:MIC(-) 1.15e6
Sense (G1:T21)
0 1 2 3 4 5 6 7 8 9
0.00
%
100.00
1:MIC(-) 9.21e5
Antisense (A1:T21)
0 1 2 3 4 5 6 7 8 9
0.00
%
100.00
1:MIC(-) 1.27e6
Sense (G1:T21)
0 1 2 3 4 5 6 7 8 9
0.00
%
100.00
1:MIC(-) 9.68e5
Antisense (A1:T21)
0 1 2 3 4 5 6 7 8 9
0.00
%
100.00
Column Oven Temp: 25 °C
28
• Oligonucleotide therapeutics can be analyzed using a simple and
affordable benchtop instrument.
• MALDI-ISD enables simple and reliable sequencing of antisense
oligonucleotides.
• There is no need to interpret complicated MS/MS spectra, which saves labor
and time.
benefits
Sequence Analysis of Antisense Oligonucleotides Using a
MALDI-8030 Benchtop MALDI-TOF Mass Spectrometer
Oligonucleotide Synthesis
Scaling Up
Characterization
Methods and Results
Sample Synthesized oligonucleotides modeled after 3 types of antisense
oligonucleotide therapeutics (mipomersen, nusinersen, and
inotersen) (Table 1)
Concentration
and Quantity
Each sample was dissolved in water to achieve a concentration of
0.1 mg/mL (about 13 to 14 pmol/μL).
Mass
Spectrometry
0.5 μL of each sample solution was placed on a MALDI target
plate, followed by layering 0.5 μL of matrix solution on top. The
samples were air-dried and analyzed using a MALDI-8030 system.
Matrix solutions consisted of either 40 mg/mL THAP (2’,4’,6’-tri
hydroxyacetophenone monohydrate) or HPA (2-hydroxypicolinic
acid), both dissolved in 50% acetonitrile with 40 mM ammonium
citrate as an additive.
Results Molecular Weight Measurement
HPA or THAP is commonly used as a matrix. When they were
also considered for the model oligonucleotide therapeutic in this
case, they were successfully ionized in the negative ion mode as
a deprotonated [M-H]- form. Adding ammonium citrate helped
inhibit any unwanted cation adducts (Figure 1).
Sequence Confirmation
In MALDI-ISD analysis of oligonucleotides, a-series ions from
the 5' side and w-series ions from the 3' side, both resulting
from cleavage at a single phosphodiester bond, are uniquely
observed (Figure 2). Using HPA as the matrix, it was found that
oligonucleotide therapeutics with phosphorothioate and various
other chemical modifications still generate a continuous series
of ISD peaks (Figure 3). Due to the simplicity of the mass spectra
composed of singly-charged ions, manual analysis is possible, but
automated analysis can also be performed using LabSolutions
Insight Biologics.
Molecular Weight Confirmation
Conclusion
Because MALDI preferentially produces singly-charged ions, mass confirmation of synthetic oligonucleotides can be achieved easily without interpreting
complicated mass spectra. Furthermore, the ability to perform MALDI-ISD measurements with an instrument lacking MS/MS capability means the internal
sequence of oligonucleotides can be confirmed using a simple benchtop-type linear MALDI-TOF MS system. That also enables the sequencing of model
oligonucleotide therapeutics that contain various chemical modifications based on the consecutive ISD fragment ions originating from a simple cleavage.
<Acknowledgements>
This research was supported by AMED under Grant Number JP21ae0121022, JP21ae0121023, JP21ae0121024 (Project leader: Satoshi Obika).
Figure 3 Example of the result of a model oligonucleotide therapeutic analysis using LabSolutions
Insight Biologics.
Figure 1 Negative-Ion MALDI Mass Spectrum of
Mipomersen Using THAP as a Matrix
Figure 2 Ion Fragmentation Nomenclature of
Oligonucleotides Observed from MALDI-ISD
Table 1 Three Types of Model Compounds
Created By Engineer, Data: n_Mipo_10shots_LP65_0001:E1 12 July 2022 13:31:05 Cal:Named Calibration "LockMass at 7175.7 Da " by Engineer on 12 July 2022 13:32:05
Shimadzu MALDI-8030: Tuning Linear negative, Power 65, P.Ext at 7000.00 (bin 206), Ion Gate Blanking: 500.00
% Intensity
0
5
10
15
20
25
30
35
40
45
50
55
60
65
70
75
80
85
90
95
100
m/z
2500 3000 3500 4000 4500 5000 5500 6000 6500 7000 7500 8000
Processed data (averaged) : 21.8 mV [sum=18373.2 mV], Smoothed = 30, profiles # 1 - 841
7175.7
3587.3
[M-H]-
[M-2H]2-
R O 1
O
O
R2 O
O
O
S HO P
a-series
w-series
5’-terminus
3’-terminus
Name Chemical formula Mw Note
Mipomersen C230H324N67O122P19S19 7177.2 ASO, PS (full), 2'-MOE, 20 mer
5’-G*-mC*-mC*-mU*-mC*-dA-dG-dT-dmC-dT-dG-dmC-dT-dT-dmC-G*-mC*-A*-mC*-mC*-3’
Nusinersen C234H340N61O128P17S17 7127.2 ASO, PS (full), 2'-MOE, 18 mer
5’-T*-mC*-A*-mC*-T*-T*-T*-mC*-A*-T*-A*-A*-T*-G*-mC*-T*-G*-G*-3’
Inotersen C230H318N69O121P19S19 7183.1 ASO, PS (full), 2'-MOE, 20 mer
5'-T*-mC*-T*-T*-G*-dG-dT-dT-dA-dmC-dA-dT-dG-dA-dA-A*-T*-mC*-mC*-mC*-3'
* = 2‘-O-(2-methoxyethyl) m = 5-methyl d = 2‘-deoxy
29
Dual-Polarity Benchtop Linear MALDI-TOF Mass Spectrometer
MALDI-8030/MALDI-8030 Easycare
Features
The MALDI-8030 is a benchtop linear MALDI-TOF mass spectrometer with a compact footprint. It is used for quality control and profiling of
peptides, proteins, polymers and oligonucleotides. It is equipped with an automated, rapid UV laser-based ion source cleaning function (TrueClean)
that can clean the ion extraction electrode without breaking vacuum.
Sample Target Solutions
Compatible with the FlexiMass series of microscope slide-format sample targets, these
slides provide researchers with options that align with their experimental workflow.
The individually barcoded, single-use FlexiMass-DS slides provide a convenient solution
for more routine or defined workflows. Ready-to-use, these disposable targets eliminate
the need for cleaning and the risk of carryover. Alternatively, the reusable stainless steel
FlexiMass-SR sample targets provide a cost-effective, longer-term solution to sample
preparation.
Automated Source Cleaning
TrueClean
To maintain instrument performance over time, the MALDI-8030 features wide-bore ion optics which
minimize the risk of source contamination and provide a robust platform. TrueClean, an automated
source cleaning function, cleans the extraction electrode in-situ quickly within 10 min by using a UV laser
without breaking instrument vacuum.
High Quality with Low-running Costs
For improving product performance and longevity, components were
carefully selected to realize a robust platform capable of delivering
outstanding performance in a small footprint. The simple design provides
easy maintenance and contributes to maintaining the quality of analysis
over time.
Database Management
MALDI Solutions software features a centralized, secure Microsoft
SQL database which can be used to store everything from sample lists
and acquisition Parameter Sets to acquired MALDI data. The system is
managed by an administrator and customizable user profiles provide
control over access to the database and operation of the instrument.
• Dual-polarity linear mode MALDI-TOF
(positive- and negative-ion mode)
• 200 Hz solid-state laser, 355 nm
• Load-lock chamber for fast sample introduction
• UV laser-based source cleaning (Pat. US 10340131)
• Small footprint/benchtop design
• Quiet operation (<55 dB)
30
• Using a MALDImini-1 spectrometer in combination with LabSolutions Insight Biologics
software, both molecular weight and sequences can be analyzed, with process steps
from measurement to data analysis completed within about 10 minutes.
• The compact MALDImini-1 system enables space-efficient operation within
facilities with limited space.
benefits
Oligonucleotide Analysis Using the Compact MALDImini-1
MALDI Digital Ion Trap Mass Spectrometer
Characterization
Methods and Results
Sample Synthetic oligonucleotide used as a model sequence for an antisense
oligonucleotide (nusinersen)
(For the sequence, refer to the MALDI-8030 information on p. 22.)
Concentration
and Quantity
A 20 pmol/μL aqueous solution was prepared as the sample
solution.
Analysis After preparing a 1:1 mixture (v/v) of sample and matrix solutions,
1 μL of the mixture was spotted onto a sample plate, dried,
and measured. Matrix solutions were prepared by dissolving 40
mg/mL concentrations of 3-hydroxypicolinic acid (3-HPA) and
2,4-dihydroxyacetophenone (2,4-DHAP) respectively in a 50/50
acetonitrile/water (v/v) solution that contains 70 mM diammonium
hydrogen citrate. A 3-HPA/2,4-DHAP mixture matrix solution was
prepared by mixing a 1:1 (v/v) ratio of the 3-HPA and 2,4-DHAP
solutions.
Samples were measured by raster scans using the MALDImini-1.
Separate condition settings were used for molecular weight analysis
and sequence analysis.
Results • The molecular weight analysis detected [M+H]+ .
• The sequence analysis detected a large number of mostly singlycharged
fragment ions limited to the series of fragment ions
cleaved from a specific linkage.
• Data acquired by MALDImini-1 molecular weight analysis and
sequence analysis was output and analyzed using LabSolutions
Insight Biologics software to quickly obtain identification results.
The predicted sequence displayed based on MALDImini-1
fragment characteristics was simple.
Molecular Weight Analysis Results
Sequencing Results
Figure 2 Part of Results from Using LabSolutions Insight Biologics to Analyze MALDImini-1 Data
Figure 3 Fragment Spectra using MALDImini-1
Figure 4 Example of Partial MALDImini-1 and LabSolutions Insight Biologics Data Analysis Results, Sequence Coverage (left) and Identification Results (right) Window Display,
where s = Thiophosphorate, e = Methoxyethoxy, and m = Methyl
[M+H]+
5000 6000 7000 8000 9000 10000 m/z
Int.[%]
100
50
0
x5
5000 m/z 6000 7000
Int.[%]
100
50
0
x2 x2 x2
1000 2000 3000 4000
m/z
Int.[%]
100
50
0
[M+H]+
w17
a17
w16
a16
w15
a15
w14
a14
w13
a13
w12
[2M+3H]3+
a12
w11
a11
w10
a10
w9
[M+2H]2+
a9
w8
a8
w7
a7
w6
[M+3H]3+
a6
w5
a5
[M+4H]4+
w4
a4
w3
a3
w2
Conclusion
Analysis using the compact MALDImini-1 spectrometer with LabSolutions Insight Biologics oligonucleotide sequencing software enables highly reliable
sequence analysis based only on singly-charged ions. The space-efficient system provides quick and easy sequencing analysis.
Figure 1 Mass Spectrum Measured by MALDImini-1
31
MALDI Digital Ion Trap Mass Spectrometer
MALDImini-1
Features
Despite its light and compact shape, the MALDImini-1 allows high-sensitivity MSn measurements, making it suitable for a large number of applications.
The MALDI-MS that can be installed anywhere
Until now, devices for MSn have had strenuous installation requirements, but the MALDImini-1's compact size and
power requirements make it easy to install almost anywhere.
Easy access to the instrument allows users to quickly acquire data and check their results, creating a more convenient
workflow right on the bench.
Digital Ion Trap (DIT) technology provides high sensitivity over a wide mass range,
despite the device's small footprint
The world-first* Digital Ion Trap (DIT) technology, unique to Shimadzu, uses rectangular wave RF to trap ions rather than the sine wave RF which has
been used in ion-trapping devices until now.
Driving waveform in a
conventional ion trap
To adjust the voltage, a large high
voltage power supply and a coil to
produce sine wave RF are required.
Driving waveform in the DIT
A large high voltage power supply is not required to
adjust the frequency.
As of May 2019, from internal research
Smaller electronics make it possible to trap
ions in a higher mass range
Because a frequency scan is used as the mass separation method, it is
possible to make MS/MS and even MS3 measurements with a device far
smaller than one using a Triple Q or TOF/TOF configuration.
High voltage
DC supply
RF switch
DIT layout
Preparation Vacuum setup Analysis
Place the sample onto the plate
(FlexiMass™-SR or FlexiMass-DS can be used)
Insert the plate into the device
and wait for the vacuum
Begin analysis
Begin taking measurements quickly
MALDI lends itself to quick analysis through simple sample preparation and acquisition. Once the sample is loaded, users can
acquire a spectrum in a few minutes at the click of a button.
With such a smooth and quick setup, it is possible to carry out detailed structural analyses in a very short time span.
MSn analysis is possible over a wide mass range, even with microquantity samples
By combining a MALDI ion source with Digital Ion Trap (DIT) technology, it is possible to carry out high-sensitivity MS and MSn
analysis even on micro-quantity samples. Not only can the mass of various molecules be checked, but it is also possible to carry out
a wide range of analyses such as identifying proteins and investigating the structure of glycans and glycopeptides.
32
Thermal Stability Analysis of Oligonucleotides by
New Tm Analysis System
Characterization and Quality Control
• Easily determine the temperature at which 50 % of double-stranded
nucleic acids dissociate into single strands (Tm value).
• Automate annealing (pretreatment) and Tm value analysis using the
average and derivative methods.
• Achieve the industry’s highest data integrity when linked to the
LabSolutions DB/CS system.
benefits
Methods and Results
Sample
Forward
Reverse
M13 primer
5’-CGACGTTGTAAAACGACGGCCAGGA-3’
5’-TCCTGGCCGTCGTTTTACAACGTCG-3’
Concentration 12 μM of 10 mM phosphate buffer (containing 17 mM NaCl)
Analysis
Conditions
Listed in Table 1
Results Results calculated by two methods (median method and
differential method) are shown in Table 2.
The median method calculates the Tm value (melting temperature)
as the point where the absorbance curve intersects the median
line between two lines tangent to respective segments selected in
the regions before and after the transition region. The Tm value
was determined by arbitrarily specifying the regions before and
after the transition, as shown in Figure 1.
The differential method calculates the first-order derivative of
each point with the specified interval and determines the Tm
value (melting temperature) as the point where the maximum
value occurs. The evaluated region was specified arbitrarily to
determine the Tm value, as shown in Table 2.
Table 1 Measurement Conditions
Instruments: UV-2600i、TMSPC-8
Measuring Wavelength: 260 nm
Measuring Wavelength
(for Calibration):
320 nm
Slit Width: 2.0 nm
Temperature Range: 15 to 90 °C
Acquisition Rate: 1 °C
Temperature Changing Speed: 1 °C / min
Cell: 8-cell micro cell with 1 mm optical path length
Table 2 Measurement Results of the Sample
Analysis Method Tm value (°C)
Average Method 65.47
Derivative Method 65.98
Conclusion
The Tm analysis software can be used to calculate Tm values for evaluating the quality or stability of double-stranded DNA or RNA. In addition, calculated
Tm values for a variety of concentrations (C) can be used for more detailed hybridization analysis.
Figure 1 Absorption Spectrum
Figure 2 Absorption Spectra of Sample (Upper: Median Method; Lower: Differential Method)
(4)
Average Method
Derivative Method
33
Features
Tm analysis system, TMSPC-8, is connected to a spectrophotometer and measures the Tm of oligonucleotides by heating and cooling. The rate of
temperature increasing/decreasing can be selected from 12 levels of ± 0.1, 0.2, 0.5, 1, 2 and 5 °C. There are 2 types of 8 micro-multi-cells with optical
path lengths of 10 mm (minimum sample volume of 100 μL) and 1 mm (minimum sample volume of 10 μL), and these cells allow measuring 8 types of
samples simultaneously in parallel.
UV-Vis Spectrophotometer
Tm Analysis System
Reliable Data Integrity
The Tm analysis system in conjunction with LabSolutions DB/CS can achieve the highest data integrity levels in the industry. Measurement parameters,
audit trails, and results of data acquisition and analysis are managed in a database protected with user privilege settings and security policies to prevent
unintended operations or data tampering by operators.
Functionality for Satisfying Various Needs
In addition to trace measurement and high-sensitivity measurement capabilities required for Tm analysis, the system satisfies a variety of other needs,
including thermodynamic parameter analysis using functionality for automatically transferring data to an Excel file.
Efficient Automated Workflow
Conventional Tm analysis requires multiple steps, including checking the UV-Vis spectrum, annealing, measuring the melting curve, and
analyzing data, with recording and data management performed separately.
In contrast, Tm Analysis System achieves a seamless workflow and efficient Tm analysis by performing time-consuming annealing,
correction (background wavelength and temperature blank correction), and Tm value calculation (average or derivative methods) steps
automatically.
8-Cell Micro Multi-Cell
This micro multi-cell can be used to measure eight samples at the same
time using the same measurement conditions.
In addition to previous micro multi-cell models with a 10 mm optical
path length (with a 100 μL minimum sample volume) for satisfying highsensitivity
measurement needs, a new model with a 1 mm optical path
length (with a 10 μL minimum sample volume) for measuring microquantities
of expensive samples has been added to the lineup. Cells with
a 1 mm optical path length can result in sample evaporation problems,
but a new sealing method*, which suppresses the evaporation of
samples by sealing the top side of the cell, enables reliable measurement
of samples with high melting temperatures.
*The sealing method was supported by Professor Junji Kawakami
(Department of Nanobiochemistry, Faculty of Frontiers of Innovative
Research in Science and Technology (FIRST), Konan University, Japan).
This was supported by AMED under Grant Number JP21ae0121022,
JP21ae0121023, JP21ae0121024 (Project leader: Satoshi Obika).
1 mm Optical Path Length
Micro Multi-Cell
10 mm Optical Path Length
Micro Multi-Cell
Melting Curve of Nucleic Acid (M13 Primer)
(Using Micro Multi-Cell with 1 mm Optical Path Length)
Absorbance at 260 nm (Abs)
34
Efficient Analysis of Residual Solvents in Pharmaceuticals Using the Compact
Model, Brevis GC-2050 —JP18 and USP467, Water-Soluble Samples—
Quality Control
Note: The data shown is not from analyzing an oligonucleotide therapeutic.
• The slim and compact design of the Brevis GC-2050 enables the expansion
of the number of operational units in the laboratory, allowing for efficient
high-throughput analysis.
• Brevis GC-2050 can perform analysis using alternative carrier gases.
• Analysis can be performed with tert-butyl alcohol and cyclopentylmethyl
ether, which have been newly added as Class 2 solvents in ICH Q3C (R8).
benefits
Methods and Results
Sample Class 1 and 2 standard solutions (water-soluble samples)
Analysis
Conditions
Listed in Table 1.
Results Results from analyzing a class 1 standard solution (water-soluble
sample) by operating method A are shown in Figure 1 and results
from analyzing a class 2 standard solution (water-soluble sample)
are shown in Figure 2 (with class 2A: black; class 2B: pink; TBA,
CPME, and MiBK: blue).
For class 1 residual solvents, good S/N ratios were obtained in
carbon tetrachloride analysis required for checking the sensitivity.
For class 2 residual solvents, good system suitability results were
obtained both operating method A (1.0 or greater separation
between acetonitrile and dichloromethane peaks) and operating
method B (1.0 or greater separation between acetonitrile and cis-
1,2-dichloroethene peaks).
Table 1 Analytical Conditions
GC Analytical Conditions (Procedure A and B)
Model : Brevis GC-2050
Detector : FID (Flame Ionization Detector)
Column : A) SH-I-624Sil MS
(0.32 mm I.D.×30 m, d.f.= 1.8 μm)
B) SH-PolarWax
(0.32 mm I.D.×30 m, d.f.= 0.25 μm)
Column Temperature : A) 40 °C (20 min) –10 °C/min –240 °C (20 min)
Total 60 min
B) 50 °C (20 min) –6 °C/min –165 °C (20 min)Total
59.17 min
Injection Mode : A) Split 1:5
B) Split 1:10
Carrier Gas Controller : Linear velocity (He, N2, H2)
Linear Velocity : 35 cm/sec
Detector Temperature : 250 °C
FID H2 Flow Rate : 32 mL/min
FID Make up Flow Rate : 24 mL/min (N2)
FID Air Flow Rate : 200 mL/min
Injection Volume : 1 mL
HS-20 NX Analytical Conditions (Same for Procedure A and B)
Model : HS-20 NXUSTL (Ultra Short Transfer Line)
Oven Temperature : 80 °C
Sample Line Temperature : 110 °C
Transfer Line Temperature : 120 °C
Vial Shaking Level : Off
Vial Volume : 20 mL
Vial Equilibrating Time : 60 min
Vial Pressurizing Time : 1 min
Vial Pressure : 75 kPa
Loading Time : 0.5 min
Load Equilib. Time : 0 min
Needle Flush Time : 5 min
Conclusion
Even though the Brevis GC-2050 is small and compact, it is capable of analyzing residual solvents in pharmaceuticals in accordance with the JP18 and
USP General Chapters<467> Residual Solvents. That compactness means the number of units installed in a laboratory can be increased compared with
high-end models, so residual solvents in pharmaceuticals can be efficiently analyzed.
Figure 1 Class 1 Standard Solution Chromatogram (Water-Soluble Sample) Using Procedure A.
1,1-Dichloroethane 2. 1,1,1-Trichloroethane
3.Carbon tetrachloride 4.Benzene 5.1,2-Dichloroethane
Figure 2 Class 2 Standard Solution Chromatogram (Water-Soluble Sample) Using Procedure A
Note: Separation values shown are intended for reference purposes and are not guaranteed.
0.0 1.0 2.0 3.0 4.0 5.0 6.0 7.0 8.0 9.0 10.0 min
1
3
4
5
1: Methanol
2: Acetonitrile
3: Methylene chloride (DCM)
4: trans-1,2-Dichloroethylene
5: cis-1,2- Dichloroethylene
6: Tetrahydrofuran
7: Cyclohexane
8: Methyl cyclohexane
9: 1,4-Dioxane
10: Toluene
11: Chlorobenzene
12: Ethylbenzene
13: m,p-Xylene
14: o-Xylene
15: Cumene
16: Hexane
17: Nitromethane
18: Chloroform
19: 1,2-Dimethoxyethane
20: Trichloroethene
21: Pyridine
22: Methyl butyl ketone
23: Tetraline
24: tert-Butyl alchol(TBA)
25: Cyclopentyl methyl ether
(CPME)
26: Methyl isobutyl ketone
(MiBK)
14
0.0 2.5 5.0 7.5 10.0 12.5 15.0 17.5 20.0 22.5 25.0 27.5 30.0 32.5 35.0 min
2
3 4
5
6
7
8
9
10 11 12 13
15
16
17
18
19
20
21
22
23
24
25
26
1
Class2B
Class2A
TBA, CPME
MiBK
2と3の
分離度1.7*
35
No carryover of DMF
Class 2A Procedure A Solvent: DMF
Solvent: Water
Gas Chromatograph
Brevis GC-2050
Headspace Sampler
HS-20 NX
Features
Despite its compact size, the Brevis GC-2050 achieves uncompromised analytical performance that satisfies market needs for “a smaller, simpler, and
easier to use model that can be reliably operated in a laboratory without sacrificing analytical performance.”
Features
As an ideal solution for analyzing volatile components, the high basic
performance level and user-friendly design offer powerful backup support for
a wide variety of analytical applications in organizations ranging from research
departments to quality control.
Brevis GC-2050, HS-20 NX USTL (Ultra Short Transfer Line)
Compact without Compromises
The compact size with a width of only 350 mm increases the number of units that can be operated in confined spaces while still providing the
expandability necessary for satisfying a wide variety of analytical needs. Despite its space-efficient design, it can hold two typical capillary columns and
also supports using hydrogen or other helium alternatives as the carrier gas.
Built-in Analytical Intelligence
Using Remote Display and LabSolutions Direct functionality, GC systems can be accessed from anywhere using a smart device (automatic remote
operations). Clean Pilot functionality can be used to automatically condition columns quickly and efficiently to ensure consistent analytical results while
reducing laboratory workloads.
Best-in-Class Performance
It achieves extremely high area and retention time reproducibility while maintaining the same performance levels as top-of-the-line
models.
Ultra-low carryover
The HS-20 NX series uses the isolation gas flow to reduce carryover to 1/10 of
conventional models. It supports a wide range of chemical species, including
high-boiling point compounds and high-polar compounds, and provides
reliable analytical results.
In the residual solvents analysis of medicines, analysis with an aqueous solvent
may be performed after analysis with a DMF solvent. With the HS-20 NX,
carryover of DMF is not a problem. HS-20 NX is effective for the analysis of
samples with different type of solvents or large concentration differences.
36
Analysis of Elemental Impurities in Oral Drug Products Using ICPMS
—The Japanese Pharmacopoeia Eighteenth Edition—
Quality Control
Note: The data shown is not from analyzing an oligonucleotide therapeutic.
• Robust quantitative analysis of control thresholds even when Option 1 (ICH
Q3D) is used to convert PDEs to concentration limits
• Easily meets acceptance criteria for accuracy and precision for the
analytical procedure used to quantify elemental impurities
• Preset methods eliminate the labor needed to establish analytical
conditions and allow anyone to perform analysis with ease
benefits
Methods and Results
Sample Oral drug products (OD gastrointestinal drug tablets) (not an
oligonucleotide therapeutic)
Concentration
and Quantity
Target concentration: Option 1 (quantity of drug administered
per day: 10 g) was used to calculate concentration limit values
converted from PDE values. Target concentration J-values were
calculated by dividing concentration limit values by the dilution
factor (for 250-fold dilution, refer to “Pretreatment”).
Pretreatment
(Figure 1)
4 mL purified water, 4 mL nitric acid, and 0.5 mL hydrochloric
acid were added to about 0.2 g of the test samples, which were
digested in a microwave digestion system (for about 60 min
at 200 °C. (The hydrochloric acid was added to stabilize the
concentration levels of Hg and certain other elements in the
solution.) The digestion vessel was cooled to room temperature
and then filled to 50 mL (250-fold dilution).
Process blank solutions were also prepared to check the
contamination level of each element during decomposition.
Analysis
Conditions
High-frequency output: 1.20 kW
Plasma gas flow rate: 9.0 L/min
Auxiliary gas flow rate: 1.10 L/min
Carrier gas flow rate: 0.85 L/min
Cell gas: He
Standard substances: Standard multi-element mixture solution
for ICHQ3D oral drugs (Cd, Pb, As, Co, V, and Ni) and standard
individual element mixture solution (for internal standard) for
ICHQ3D standard mercury solution (Sc, Ga, In, and Bi).
Results Converted concentration in test sample solid: Concentrations in
solids were converted by subtracting process blank concentrations
from the sample solution concentrations and multiplying the
result by the dilution factor. Concentrations in the sample
solution were equal to or less than the J-value for all elements.
Compliance standards for pharmacopoeia quantitative testing
include trueness with a spike recovery rate within 70 to 150
%, accuracy with an RSD value of 20 % or less, and a limit of
quantitation that satisfies the trueness standard for concentrations
of 0.5 J or less.
For the analytical results in this case, the spike recovery rates were
within 94 to 104 %, RSD was 3 % or less, and all results easily
satisfied compliance standards. Additionally, the results confirmed
that the 10 σ value was more than adequately low, at one-tenth
or less of the 0.5 J criterion value. (Table 2)
Table 1 Equipment Configuration
Instrument: ICPMS-2050
Nebulizer: Nebulizer DC04
Chamber: Cyclone Chamber
Torch: Mini-Torch
Skimmer Cone: Nickel
Autosampler: AS-20
Internal Standard Elements: Online Internal Standard Kit
(sample: internal standard = about 9 : 1)
Conclusion
The results confirmed that performance easily satisfied the pharmacopoeia trueness, accuracy, and quantitation limit compliance standards. In addition,
the preset methods in LabSolutions ICPMS can reduce the time and trouble involved in evaluating measured masses and analysis conditions. The above
results confirm that the ICPMS-2050 system is useful for analyzing elemental impurities in oral drug products.
Figure 1 Sample Preparation Procedure
Table 2 Quantitative Results
(1) Place the acid and
test sample in the
digestion vessel
(2) Digest in a microwave
digestion system
(3) Make up to a
fixed volume
Cool
Class Element IDL
[μg/L]
Preparation
Blank
Concentration
[μg/L]
Sample Solution
Concentration
[μg/L]
Concentration
in Solid Sample
[μg/g]
Spiked to 50 % of the
Target Concentration
Spiked to 100 % of the Target
Concentration
Spiked to 150 % of the
Target Concentration
Spiked
Concentration
[μg/L]
Recovery
[%]
Spiked
Concentration
[μg/L]
Recovery
[%]
RSD
[%]
Spiked
Concentration
[μg/L]
Recovery
[%]
1
111Cd 0.006 N.D. N.D. N.D. 0.3 94 0.6 97 2.2 0.9 96
208Pb 0.001 0.005 0.029 0.006 0.3 102 0.6 103 0.95 0.9 103
75As 0.01 N.D. N.D. N.D. 0.9 103 1.8 100 0.74 2.7 99
202Hg 0.003 N.D. N.D. N.D. 1.8 96 3.6 96 0.94 5.4 97
2A
59Co 0.003 N.D. N.D. N.D. 3 100 6 100 0.73 9 100
51V 0.02 N.D. N.D. N.D. 6 103 12 104 0.93 18 104
60Ni 0.1 N.D. 0.2 0.05 12 104 24 104 0.60 36 104
IDL = Standard deviation upon repeated analysis of the blank solution × 3 × Calibration curve slope
N.D. = Not Detected
37
Narrow
Injector bore diameter
Wide
Plasma temperature = 7500 K
New design
Previous design
~2 times higher
sensitivity
Features
The ICPMS-2040/2050 Series systems have achieved a harmonious
blend of environmental-friendliness and analytical performance through
the advanced proprietary Mini-Torch system. Without the need for any
special options, the systems reduce measurement time, contributing to
the optimization of your workflow efficiency. Moreover, the software
comes with various functions, options, and maintenance information that
minimize operator intervention, revolutionizing the way you work.
ICP Mass Spectrometer
ICPMS-2040/2050
Eco Friendly yet Competent
The features of Shimadzu’s mini-torch system, which consistently reduces argon gas
consumption to approximately two-thirds, and can use low-purity (99.95 %) gas, remain.
At the same time, optimizing the torch design decreases sample flow rate into the plasma,
improving sample ionization efficiency. The new design roughly doubles sensitivity compared
to previous models.
Fast at No Additional Cost
The improved gas controller features high-speed cell gas
purging.
Combined with ProActive Rinsing, measurement times can
be significantly shortened.
Minimal Operation Required
Extended Rinsing
—Automatically Minimizes Carryover—
The extended rinsing function automatically performs an
additional rinse sequence when a target element exceeds a
predetermined upper limit. A second rinse solution can be
used in the additional rinsing sequence to improve rinsing
effectiveness. Consequently, carryover is eliminated to
ensure high-quality data.
Dual Valve Unit
—Enables Autonomous Operation after Plasma Ignition—
When using an Online Internal Standard Kit (optional),
the operator must move the probe before and after data
acquisition. The optional Dual Valve Unit allows seamless
switching between tuning solution and rinsing solution
while also automatically adding internal standard solution
to samples. The entire sequence, from instrument tuning
and measurement to rinsing and plasma off, is performed
automatically.
5 hr and 40 min
Previous
model
ICPMS-2040/2050 Series
4 hr
Measure a series of
100 samples (example)
About 1 hr and 44 min Time Reduction
23 sec × 100 = 2300 sec
Time reduction due to gas purging
Time reduction due to ProActive Rinsing
40 sec × 99 = 3960 sec
Automatically performs additional
rinsing after measuring samples with a
high concentration of target elements.
Remeasurement required due to
carryover
Normal Sequence
With Extended Rinsing ON
High
concentration
of target
elements
Executed
automatically
Sample 1 Sample 2
Carryover
Rinse Rinse Rinse Sample 3’
Rinse Rinse Additional
rinse Sample 3
Sample 3
Sample 1 Sample 2
Tune instrument Start measurement Rinse instrument
Normal
Ignite plasma Extinguish plasma
Operator does not need to move the probe
Operator moves the probe
Automatic
Dual valve unit used
Ignite plasma
38
Quantitation of Double-stranded DNA
– Trace Measurement Using TrayCell and Nano Stick –
Characterization and
Quality Control
• Enables spectrum acquisition with ultrafast scanning at a maximum speed of 29,000 nm/min.
• The use of TrayCell (manufactured by Hellma Analytics) and Nano Stick (manufactured
by SINCO) enables measurement from a sample volume of as little as 3 μL.
• The quantitative value of oligonucleotide concentration can be calculated by
using the oligonucleotide quantification function in Biomethod.
benefits
Methods and Results
Sample Double-stranded DNA
Conc., Volume 1 ~ 300 ng/mL, 2 μL
Preparation Dilution in ultrapure water to the concentrations above.
Analytical
Conditions
As shown in Table 1
Method for
Measuring
Double-
Stranded DNA
Using TrayCell
We prepared ds DNA and standard samples at 27.5, 55, 110, 220,
and 440 ng/μL (ultrapure water was used as the dilution solution).
For samples with unknown concentrations, we prepared the same
DNA by ethanol precipitation. The TrayCell can be changed to
optical path lengths of 1.0 mm and 0.2 mm by using two different
lids. In this test, we used a lid with an optical path length of 1.0
mm, dropped 4 μL, and measured under the conditions listed in
Table 1 (Figure 1).
Method for
Measuring Double-
Stranded DNA
Using Nano Stick
We prepared standard and unknown samples of ds DNA as well as
the above TrayCell. We also set the analysis conditions as listed in
Table 1. The optical path length of the Nano Stick was 0.5 mm, and
the sample volume was measured at 3 μL (Figure 2).
Results Figures 3 and 4 show the calibration curve and UV spectrum results
when measured using TrayCell and Nano Stick. Both results indicate
a highly linear calibration curve. We repeatedly measured 440 ng/
μL 10 times. As a result, the correlation function and CV value
were calculated, and it was confirmed that the measurement was
performed accurately.
Table 1 Analysis Conditions
Wavelength (calibration curve): 260 nm, 320 nm
Wavelength range: 220 nm ~ 330 nm
Scan Speed : Low
Sampling Pitch: 1 nm
Conclusions
This application news has shown that the UV-1900i, TrayCell, and Nano Stick can be used to make accurate and simple measurements even for small
samples of the order of several μL.
1. The sample is placed in the central
silver region.
3. Set the cell holder with Traycell
Figure 2 What the Nano Stick Looks Like and How To Use It
4. After measurement, wipe the
sample with a Kim wipe.
2. Set the lid on
Figure 1 TrayCell Appearance
Figure 3 Results of measurements using TrayCell
Figure 4 Results of measurements using the Nano Stick
ー Unknown sample
concentration
ー 440ng/μL
ー Unknown concentration
sample (3 times dilution)
ー 220ng/μL
ー 110ng/μL
ー 55ng/μL
ー 27.5ng/μL
ー Unknown sample
concentration
ー 440ng/μL
ー Unknown concentration
sample (3 times dilution)
ー 220ng/μL
ー 110ng/μL
ー 55ng/μL
ー 27.5ng/μL
39
UV-Vis Spectrophotometer
UV-1900i Plus
Features
The UV-1900i Plus spectrophotometer features a space-saving and ergonomic hard design. It is equipped with a color touch panel and adopts a user
interface (UI) that allows users to easily and quickly obtain answers. In addition, six types of measurement conditions are built in: 1. Oligonucleotide
quantification, 2. Lowry method, 3. BCA method, 4. CBB (Bradford method), 5. Biuret method, and 6. UV absorption method. It also has a screen shot
function on the operation panel, so you can easily extract measurement results without connecting to a PC. A 10 mm square cell requires a sample
volume of approximately 4 mL, but the TrayCell or Nano Stick can be used to measure trace amounts of about 2 μL to 4 μL.
High Performance to Meet Diverse Needs
High Speed Scan Spectra can be acquired as fast as 29,000 nm/min. Ultra-fast scanning is effective for tracking chemical
reactions in a short time. In addition to the absorbance change at specified wavelengths, spectra can also
be acquired in a short time with the UV-1900i Plus.
Therefore, more detailed behavior can be investigated by observing spectra with the UV-1900i.
Low Stray Light Stray light is at 0.5 % max. (198 nm), making accurate measurements possible up to the vicinity of 2 Abs
even in the ultraviolet region. In addition, high-concentration samples can be quantified accurately.
High Reproducibility and
Repeatability Accuracy
High repeatability of less than 0.0002 Abs reduces variation in measurement results. And it enables more
accurate quantitative analysis and detection of lower concentrations of samples.
A Diversity of Measurement
Modes
UV-1900i Plus features six measurement modes: Photometric, Spectral, Quantitative, Kinetics, Timecourse,
and Biomethod.
Full Support for Pharmacopeia, GLP/GMP, FDA 21 CFR Part 11 and Other Regulations
Instrument Validation Functions
Compliant with JP, USP, and EP
This instrument can not only run checks for nine JIS items, but also those stipulated in the Japanese
Pharmacopoeia (JP), United States Pharmacopeia (USP), and the European Pharmacopoeia (EP). Naturally,
the hardware is also compliant with the specifications required by each Pharmacopeia. In addition, the
check conditions can be saved. As a result, once the conditions are saved, checks can be performed easily
just by calling them up as needed. Check results can also be saved.
Resolution of 1 nm,
the Highest in its Class
In addition to achieving a resolution of 1 nm, the highest in its class, by using a monochromator with a
Czerny-Turner mounting, the UV-1900i also features a compact, bright optical system. The instrument is
more than capable of meeting the wavelength resolution required in the European Pharmacopoeia.
Improved Security Functions An external control security function has been added to provide more support for compliance with
regulations. Three user authority levels, "Administrator", "Developer", and "Operator", can be set for
instrument users.
Support for Regulations and
Guidelines
Ensuring the integrity of data (database management), including the user management, user authority
management, and data audit trails, required for compliance with FDA 21 CFR Part 11, PIC/S GMP
guidelines, and other ER/ES regulations is possible.
LabSolutions DB UV-Vis or UVProbe / LabSolutions DB System allows for data management and user
management with a database. Compliant with ER/ES regulations, the system is optimally configured for
customers using a PC.
LabSolutions CS UV-Vis or UVProbe / LabSolutions CS System (Network System) is optimally configured
for customers who want to manage data on a server together with LC and GC data for ER/ES compliance.
40
Pharmacokinetics
• High-sensitivity quantitation and molecular weight confirmation are
possible with one system.
benefits • Ease of maintenance helps minimize downtime.
Quantitating siRNA Oligonucleotide and Confirming Molecular
Weights Using a Triple Quadrupole Mass Spectrometer
Methods and Results
Sample 5’-pU CGAAGUAUUCCGCGUACG dTdT-3’
Average molecular weight: 6646.0
5’-pC GUACGCGGAAUACUUCGA dTdT-3’
Average molecular weight: 6669.0
Concentration
and Quantity
1 to 10000 fmol/L, 10 μL
Pretreatment Diluted with ultrapure water to the concentrations indicated above.
Measurement
Conditions
Listed in Table 1.
Results The calibration curves for AS-Oligo and SS-Oligo showed good
linearity within the 1 fmol to 10000 fmol range (Figure 1), with a
contribution rate (R2) of 0.997 for AS-Oligo and 0.995 for SS-Oligo.
The limit of detection was 1 fmol and the lower limit of quantitation
was 5 fmol. The sensitivity of MRM (multiple reaction monitoring)
analysis exceeded SIM analysis.
A SIM chromatogram from a mixture solution with 100 fmol
each of SS-Oligo and AS-Oligo is shown in Figure 2. Using ion
pair chromatography, elution times were 6.88 minutes and 6.94
minutes, respectively, with a 0.3 separation R value.
Ions with 4 to 9 charges were detected in the mass spectra (Figures
3 and 4) for both samples.
Results from using LabSolutions multi-charged ion analysis
functionality to calculate molecular weights resulted in estimated
AS-Oligo and SS-Oligo molecular weights of 6645.0 and 6667.2,
respectively, with an error factor of 1.0 Da and 1.8 Da from the
average molecular weights.
Table 1 Measurement Conditions
［HPLC conditions］(Nexera)
Column: Commercial C18 column(100 mm×2.1 mmI.D., 1.7 μm)
Mobile Phases: A)200 mM HFIP*1 and 7.5 mM TEA*2/water
B)Methanol
Gradient Program: B conc. 4 %(0 min) － 20 %(8.0 min)
Flow Rate: 0.2 mL/min
Column Temp.: 75 °C
Injection Volume: 10 μL
［MS conditions］(LCMS-8060)
Ionization: ESI(Negative mode)
Probe Voltage: -3 kV
Mode: Q3scan(m/z 500-1800)
SIM m/z 1666.0(SS), m/z 1659.9(AS)
Nebulizing Gas Flow: 3.0 L/min
Drying Gas Flow: 5.0 L/min
Heating Gas Flow: 15.0 L/min
DL Temp.: 250 °C
Heat Block Temp.: 500 °C
Interface Temp.: 350 °C
*1 1,1,1,3,3,3-Hexafluoro-2-propanol
*2 Triethylamine
Conclusions
Using an LCMS-8060 triple quadrupole mass spectrometer for SIM quantitative analysis of siRNA oligonucleotides resulted in a mass spectrum with low
resolution, but the multi-charged ion analysis functionality was able to confirm molecular weights within an error range of several Da.
Figure 4 Spectrum from Multi-Charged Ion Analysis of AS-Oligo
6645.6
FIgure 2 SIM Chromatogram
Figure 3 Mass Spectra of AS-Oligo
Figure 1 Calculation Curves Obtained from SIM Chromatograms
41
Triple Quadrupole LC-MS/MS
LCMS-8060RX
Features
LCMS-8060RX is a triple quadrupole mass spectrometer that combines high speed and high sensitivity.The mass range is m/z 2 ~ 2000, and molecular
weight estimation of oligonucleotide therapeutics is possible using the deconvolution function of LabSolutions LCMS software.
Triple-quadrupole mass spectrometers, which have high sensitivity and a wide dynamic range, are commonly used for quantitative analysis, such as for
pharmacokinetic analysis of drugs, but also offer qualitative capabilities. Precise mass spectrometry techniques such as MALDI-TOF and Q-TOF LC/MS are
frequently used for accurate mass molecular weight determination.
Software Solutions from Acquisition to Data Review
LabSolutions Connect MRM / LabSolutions Insight
Automatic optimization of MS conditions
MRM parameters (precursor ion m/z, product ion m/z, voltages) and ion source parameters (gas flow rate, temperature) are automatically
optimized. Just one round of comprehensive optimization maximizes sensitivity, taking into consideration polarity, adduct ions, charge
number, etc. The results of this process can be viewed on a graph using the data browser function. The MRM optimization results screen
simultaneously displays a chromatogram, a spectrum, and each voltage. From the MRM optimization results screen, check how the signal
intensity changes with variations in each parameter.
MRM optimization
Review screen for MRM optimization simultaneously displays precursor ion, product ion, and voltage
results..
Ion source optimization
Review screen for source optimization graphically displays the successive results of each parameter
modification.
42
Development of New Analysis Methods
• Enables the separation of phosphorothioate-modified short-chain
oligonucleotide impurities.
• In some cases, using SFC can provide different selectivity from LC.
• Using preparative SFC evaporates the carbon dioxide, one of the solvents,
which simplifies post-treatment.
benefits
Short Oligonucleotide Analysis
Using Supercritical Fluid Chromatography
Methods and Results
Sample 5’-ToToToT-3’
5’-TsToToT-3’
5’-TsToTsT-3’
5’-TsTsTsT-3’
T: Thymidine, o: phosphodiester linkage, s: phosphorothioate
linkage
Concentration
and Quantity
100 nmol/mL, 5 μL
Analysis Samples were dissolved in methanol that contains 5 % water and
analyzed using the measurement conditions listed in Table 1 to
compare the retention characteristics of each column.
Results The Diol II column was able to separate oligonucleic acids with
different PS concentrations. SIL II and HyP columns separated or
partially separated the acids. The PBT column did not retain the
oligonucleic acids, whereas the PVP, triazole, and NH2 columns all
did not elute the sequences within the given time.
The results showed that retention characteristics varied depending
on the column.
Table 1 Analytical conditions for Figure 1
System: Nexera UC
Column: Shim-pack UC-Diol II, SIL II, HyP, Triazole and NH2
(150 mm×2.1 mm I.D., 3 μm）
Shim-pack UC-PBT and PVP(150 mm×3.0 mm I.D.,
3 μm）
Temperature: 35 °C
Injection volume: 5 μL
Mobile phases: A) CO2、B)50 mmol/L ammonium formate in
methanol and water (95:5, v/v)
A/B=50:50
Flow rate: 1.0 ml/min
Detection: 260 nm (PDA coupled to a high-pressure cell)
Table 2 MS conditions
System: LCMS-9030
Polarity: Negative
Interface temp: 350 °C
Nebulizer gas: 3.0 L/min
Heating gas: 10.0 L/min
Drying gas: 10.0 L/min
DL temp: 250 °C
Heat block temp: 400 °C
Interface voltage: -3.5 kV
TOF-MS: m/z 150-2000
Figure 1 Overlayed EICs of T4s with different PS contents
Conclusions
These results indicate that SFC can be used to analyze short-chain oligonucleic acids by optimizing the column and other analysis conditions.
43
Features
Reverse-phase ion pair chromatography is typically used to analyze oligonucleic acids, but some impurities that have a similar structure to the target
substance can make separation difficult. Therefore, development of a separation method with different selectivity from the existing method is
anticipated.
Supercritical fluid chromatography (SFC) is an analysis method that uses carbon dioxide as the mobile phase at a temperature and pressure that are
both above the critical point. Because carbon dioxide has lower viscosity and higher diffusivity than regular liquids, reports have indicated that it has
higher separation and special selectivity characteristics. Meanwhile, the low polarity of mobile phases that contain carbon dioxide makes them unsuitable
for analyzing highly polar compounds. However, in recent years, it has become possible to analyze highly polar compounds, such as peptides and
nucleotides, by selecting an appropriate stationary phase and modifier composition for mixing with the carbon dioxide.
Supercritical Fluid Extraction / Supercritical Fluid Chromatograph
Nexera UC
Nexera UC systems can automatically extract target components from
solid samples using supercritical CO2 fluid and then seamlessly analyze
and separate them directly in an online process.
The unique gas-liquid separation technology used offers both easy
operation and preparative purification with high recovery rates by
inhibiting any drop in recovery rates due to eluate dispersion during
CO2 evaporation. This achieves high recovery rates even for volatile
components.
Nexera UC/s UHPLC / SFC Switching System
This system can switch automatically between SFC analysis and UHPLC analysis and make measurements on a single sample in each separation mode. It
enhances user-friendliness by allowing the investigation of separation conditions and performing reverse-phase high-speed analysis using a single system.
Shimadzu also provides a kit to upgrade from your current UHPLC system to the UHPLC/SFC switching system.
44
Development of New Analysis Methods
• Using optimized modifier containing octylamine, 18-mer modified
oligonucleotides were detected.
• As a result of optimization of analytical conditions for the separation of
deaminated oligonucleotides, 10- and 18-mer target oligonucleotides and
their deaminated products were able to be separated.
benefits
Analysis of Deaminated Oligonucleotides Using
Supercritical Fluid Chromatography
Methods and Results
Optimization of analytical conditions for separating deaminated
oligonucleotides from desired oligonucleotides
To evaluate the separation performance of deaminated oligonucleotides
with SFC, 2’-MOE-modified oligonucleotides (Figure 1) and their
deaminated sequences were used to investigate the column oven
temperature and the type of modifier additive. Since the choice of alkyl
amine greatly affected the separation ability in IP-RPLC, same way of
investigation was done on SFC (Figure 2). First, primary, secondary, and
tertiary alkylamines in same carbon number (hexylamine, dipropylamine,
and triethylamine) were investigated. No peak was detected for
triethylamine, a broad peak was detected for dipropylamine, and a
sharp peak was detected for hexylamine. Since hexylamine is the most
hydrophobic of the three alkyl amines, the hydrophobicity of the alkyl
amine was thought to be involved in the peak shape. When dibutylamine,
a secondary amine with greater hydrophobicity than hexylamine, was
employed, a broad peak was detected. This suggests that long-chain,
primary amines would be effective for obtaining good peak shapes.
Finally, octylamine was continuously used because it provided the best
peak shapes and the highest resolutions among the evaluated alkyl
amines.
Table 1 Analytical conditions for Figure 2
System : Nexera UC
Column : Shim-pack UC-Diol II
(150 mm×4.6 mm I.D., 3 μm*1)
Column oven temp. : 50 °C
Injection volume : 1 μL of 100 μmol/L oligonucleotide dissolved in
methanol and water (95:5, v/v)
Mobile phases : A) CO2
B) 50 mmol/L alkylamine and 50 mmol/L acetic acid
in methanol and water (95:5, v/v)
B conc : 30 % (0–5 min), 30–60 % (5–30 min),
60 % (30–35 min), 30 % (36–40 min)
Flow rate : 1.0 mL/min
Back pressure : 10 MPa, 50 °C
Detection : PDA 260 nm
*1 Custom-made
Figure 1 Structures of DNA and 2’-MOE-modified oligonucleotides
Figure 2 Chromatographic separations of target (peak 1 and 3) and deaminated
(peak 2 and 4) sequences using different alkyl amines inmodifiers
45
Evaluation for separation behavior of deaminated oligonucleotides
The separations of target oligonucleotides and sequences with different positions of deamination were investigated (Fig. 3). In the case of DMTr-on
10mer and -off 10-mer, the target sequence was able to be separated from deaminated sequences. In the case of IP-RPLC, some deaminated sequences
were separated from DMTr-on 10-mer, but sequence d was co-eluted. IP-RPLC showed excellent separation of both DMTr-off 10-mer and 18-mer
sequences. These results suggest that SFC and IPRPLC showed different retention behaviors in oligonucleotide analysis.
<Acknowledgments>
We would like to thank Prof. Satoshi Obika and Prof. Takao Yamaguchi (Graduate School of Pharmaceutical Sciences, Osaka University) for their
guidance. This research was partially supported by AMED under Grant Number JP21ae0121022, JP21ae0121023, JP21ae0121024 (Project leader:
Satoshi Obika).
Table 2 Analytical conditions of SFC for Figure 3
System : Nexera UC
Column : Shim-pack UC-Diol II
(150 mm×4.6 mm I.D., 3 μm*1)
Column oven temp. : 50 °C
Injection volume : 1 μL of 100 μmol/L oligonucleotide dissolved in
methanol and water (95:5, v/v)
Mobile phases : A) CO2
B) 50 mmol/L octylamine and 50 mmol/L acetic acid
in methanol and water (95:5, v/v)
B conc : 40 % (DMTr-on and -off 10-mer),
45 % (DMTr-on and -off 18-mer)
Flow rate : 1.0 mL/min
Back pressure : 10 MPa, 50 °C
Detection : PDA 260 nm
*1 Custom-made
Table 3 Analytical conditions of IP-RPLC for Figure 3
System : Nexera XS
Column : Shim-pack Scepter C18-120
(150 mm×4.6 mm I.D., 3 μm*1)
Column oven temp. : 50 °C
Injection volume : 1 μL of 100 μmol/L oligonucleotide dissolved in
methanol and water (95:5, v/v)
Mobile phases : A) 10 mmol/L propylamine (pH 9.6, adjusted with
acetic acid) in water
B) acetonitrile
B conc : 30 % (0–5 min), 30–60 % (5–30 min),
60 % (30–35 min), 30 % (36–40 min)
Flow rate : 1.0 mL/min
Back pressure : 10 MPa, 50 °C
Detection : PDA 260 nm
*1 P/N 227-31016-05
Figure 3 Chromatographic separations of target and deaminated sequences using SFC and IP-RPLC
Target (peak a, e, a’, and e’, green lines) and corresponding deaminated (peak b-d, f-i, b’-d’, and f’-i’, black lines) sequences
46
HPLC Columns
Vials
• A bioinert coating inhibits adsorption.
• A hybrid organosilica material provides high resistance to high-pH mobile
phases.
• An extensive line of stationary phases is available, such as wide-pore
packing materials suitable for medium and large molecules.
benefits
Shim-pack Scepter Claris
Inert Column
Column body
Bioinert
coating
Stainless steel
0
20
40
60
80
100
0 50 100 150 200 250 300
Liquid delivery time (hr)
Changes in number of
theoretical plates (%)
Scepter C18-120
Scepter C8-120
Silica-based monofunctional C18
Mobile phase
Flow Rate
Column Temp.
Sample
50 mmol/L triethylamine (pH 11.5)/methanol = 90/10 (v/v)
1.0 mL/min
40 °C
Benzyl alcohol
Features
Bioinert Coating Provides Outstanding Low-Adsorption Characteristics
Shim-pack Scepter Claris columns feature a column body with a bioinert
coating and a Scepter packing material.
The column offers excellent resistance to the adsorption of compounds
prone to adsorbing to metals, especially nucleic acids.
Example of siRNA Analysis
Shim-pack Scepter (stainless body) and Shim-pack Scepter Claris (body
with inert coating) columns were compared for analyzing synthetic
siRNA. This showed that sensitivity for antisense and sense chains differed
by more than a factor of 2. Moreover, a low-concentration impurity peak
was detectable using the Claris column but not with the stainless steel
body.
Durability for Using High-pH Mobile Phases
Column performance was evaluated after flushing them for a certain
period with a mobile phase that has a higher pH than used for nucleic
acid analysis (pH 11.5) to determine whether performance dropped. A
basic mobile phase resulted in a sharp drop in column performance for
the typical silica C18 column, but the Shim-pack Scepter packed with
a hybrid organosilica base material showed high resistance to the basic
mobile phase.
Extensive Variety of Stationary Phases Enables a Wide Range of Selectivity for Analysis
Shim-pack Scepter series columns are available with an extensive line of stationary phases with different separation performance, such as C4, C8, or C18
linear alkyl chains, phenyl, PFPP, and diol phases. C4 and C18 stationary phases are also available as wide-pore packing materials optimized for medium
and large molecules. They offer excellent chromatographic performance for analyzing nucleic acids, proteins, and so on.
Impurity
Antisense Sense
47
• Each vial inspected visually to ensure thorough quality control.
• Proprietary treatment (Shim-vial H glass) provides extreme inhibition of
adsorption by basic compounds.
• Inhibition of Na elution provides consistent results even for samples
vulnerable to pH changes.
benefits
High-Quality LC and LC–MS Vials
Shim-vial H glass
12
10
8
6
4
2
0
Shim-vial H Vial A Vial B
Na Elution Quantity (μg/mL)
(×10,000)
2.0
1.5
1.0
0.5
0.0
505.40 >336.30(+)
Shim-vial H
Vial C
Vial D
0.25 0.50 0.75 1.00 1.25 min
Chlorhexidine (100 μg/L, 1 μL injection)
Shim-vial H
• ppt order high-sensitivity analysis (LC–MS)
• Analysis of compounds prone to adsorption (LC–MS and LC)
• Analysis with a focus on repeatability (QA/QC)
• Analysis requiring a low background
Shim-vial S
• Analysis of general compounds (LC–MS and LC)
• ppm to ppb order high-sensitivity analysis
• Analysis with a focus on repeatability (QA/QC)
• Analysis requiring a low background
Features
Metal Ion-Exclusion Inhibits Adsorption by Basic Compounds
Presumably, the metal ions (Na) contained in the glass affect the adsorption of basic compounds. Due to a special treatment process during forming,
Shim-vial H achieve exceptional low-adsorption performance by thoroughly excluding Na ions. Even the Shim-vial S, made with a simplified version of
part of the treatment process, offers excellent low-adsorption performance.
Vial Selection by Application
Our lineup includes Shim-vial H, which enables trace-quantity analysis of basic compounds prone to adsorption by glass, thanks to advanced low
adsorption treatment, and the cost-effective Shim-vial S.
The Smallest Possible Volumes Are Achieved with High-Accuracy Machining Techniques
Our small-volume vials with their unique shape are made of the same materials and receive the same cleaning treatment as the 1.5 mL vials.
They suppress adsorption more than other small-volume inserts by limiting the contact surface between the sample and the container. In
addition, the bottom surface of the vial is hollowed out in order to increase thermal conductivity.
Residual volume: Approx. 10 μL
When using it, adjust the needle stroke parameter to be 15 mm higher than for the 1.5 mL vials.
For example: Shimadzu SIL-40 series: 32 mm or less
Oligonucleotide Therapeutics Solution
© Shimadzu Corporation, 2026 / First Edition: October 2022, 3656-03602-PDFIT, C10G-E097B
www.shimadzu.com/an/
For Research Use Only. Not for use in diagnostic procedures.
This publication may contain references to products that are not available in your country. Please contact us to check the availability of
these products in your country.
Company names, products/service names and logos used in this publication are trademarks and trade names of Shimadzu Corporation,
its subsidiaries or its affiliates, whether or not they are used with trademark symbol “TM” or “®”.
Third-party trademarks and trade names may be used in this publication to refer to either the entities or their products/services, whether
or not they are used with trademark symbol “TM” or “®”.
Shimadzu disclaims any proprietary interest in trademarks and trade names other than its own.
The contents of this publication are provided to you “as is” without warranty of any kind, and are subject to change without notice.
Shimadzu does not assume any responsibility or liability for any damage, whether direct or indirect, relating to the use of this publication.
Sponsored by
Shimadzu Corporation
Shimadzu is a world-leading manufacturer of analytical instrumentation. In every corner of the world, their products and services are being used by customers to develop a variety of new products to protect and restore the environment and deliver better health and lifestyles to people. With pride in these achievements firmly in mind, they strive to improve their technologies further and enhance their knowledge so that they can offer even greater technologies, products and services.
Download the eBook for FREE Now!
Information you provide will be shared with the sponsors for this content. Technology Networks or its sponsors may contact you to offer you content or products based on your interest in this topic. You may opt-out at any time.
Experiencing issues viewing the form? Click here to access an alternate version
